3110043O21Rik (NM_001081343) Mouse Untagged Clone

CAT#: MC216685

3110043O21Rik (untagged) - Mouse RIKEN cDNA 3110043O21 gene (3110043O21Rik), (10ug)


  "NM_001081343" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "3110043O21Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 3110043O21Rik
Synonyms AI840585; C9orf72
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216685 representing NM_001081343
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGACTATCTGCCCCCCACCATCTCCTGCTGTTGCCAAGACAGAGATTGCTTTAAGTGGTGAATCAC
CCTTGTTGGCGGCTACCTTTGCTTACTGGGATAATATTCTTGGTCCTAGAGTAAGGCATATTTGGGCTCC
AAAGACAGACCAAGTGCTTCTCAGTGATGGAGAAATAACTTTTCTTGCCAACCACACTCTAAATGGAGAA
ATTCTTCGAAATGCAGAGAGTGGGGCTATAGATGTAAAATTTTTTGTCTTATCTGAAAAAGGGGTAATTA
TTGTTTCATTAATCTTCGACGGAAACTGGAATGGAGATCGGAGCACTTATGGACTATCAATTATACTGCC
GCAGACAGAGCTGAGCTTCTACCTCCCACTTCACAGAGTGTGTGTTGACAGGCTAACACACATTATTCGA
AAAGGAAGAATATGGATGCATAAGGAAAGACAAGAAAATGTCCAGAAAATTGTCTTGGAAGGCACAGAGA
GGATGGAAGATCAGGGTCAGAGTATCATTCCCATGCTTACTGGGGAAGTCATTCCTGTAATGGAGCTGCT
TGCATCTATGAAATCCCACAGTGTTCCTGAAGACATTGATATAGCTGATACAGTGCTCAATGATGATGAC
ATTGGTGACAGCTGTCACGAAGGCTTTCTTCTCAATGCCATCAGCTCACACCTGCAGACCTGTGGCTGTT
CCGTTGTAGTTGGCAGCAGTGCAGAGAAAGTAAATAAGATAGTAAGAACGCTGTGCCTTTTTCTGACACC
AGCAGAGAGGAAATGCTCCAGGCTGTGTGAAGCAGAATCGTCCTTTAAGTACGAATCGGGACTCTTTGTG
CAAGGCTTGCTAAAGGATGCAACAGGCAGTTTTGTCCTACCCTTCCGGCAAGTTATGTATGCCCCGTACC
CCACCACGCACATTGATGTGGATGTCAACACTGTCAAGCAGATGCCACCGTGTCATGAACATATTTATAA
TCAACGCAGATACATGAGGTCAGAGCTGACAGCCTTCTGGAGGGCAACTTCAGAAGAGGACATGGCGCAG
GACACCATCATCTACACAGATGAGAGCTTCACTCCTGATTTGAATATTTTCCAAGATGTCTTACACAGAG
ACACTCTAGTGAAAGCCTTCCTGGATCAGGTCTTCCATTTGAAGCCTGGCCTGTCTCTCAGGAGTACTTT
CCTTGCACAGTTCCTCCTCATTCTTCACAGAAAAGCCTTGACACTAATCAAGTACATCGAGGATGATACG
CAGAAGGGGAAAAAGCCCTTTAAGTCTCTTCGGAACCTGAAGATAGATCTTGATTTAACAGCAGAGGGCG
ATCTTAACATAATAATGGCTCTAGCTGAGAAAATTAAGCCAGGCCTACACTCTTTCATCTTTGGGAGACC
TTTCTACACTAGTGTACAAGAACGTGATGTTCTAATGACCTTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001081343
Insert Size 1446 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081343.1, NP_001074812.1
RefSeq Size 3198 bp
RefSeq ORF 1446 bp
Locus ID 73205
UniProt ID Q6DFW0
Cytogenetics 4 A5
Gene Summary Component of the C9orf72-SMCR8 complex, a complex that has guanine nucleotide exchange factor (GEF) activity and regulates autophagy (PubMed:27193190, PubMed:27617292). In the complex, C9orf72 and SMCR8 probably constitute the catalytic subunits that promote the exchange of GDP to GTP, converting inactive GDP-bound RAB8A and RAB39B into their active GTP-bound form, thereby promoting autophagosome maturation (By similarity). The C9orf72-SMCR8 complex also acts as a regulator of autophagy initiation by interacting with the ATG1/ULK1 kinase complex and modulating its protein kinase activity (PubMed:27193190, PubMed:27617292). Positively regulates initiation of autophagy by regulating the RAB1A-dependent trafficking of the ATG1/ULK1 kinase complex to the phagophore which leads to autophagosome formation (By similarity). Acts as a regulator of mTORC1 signaling by promoting phosphorylation of mTORC1 substrates (PubMed:27875531). Plays a role in endosomal trafficking (PubMed:26989253). May be involved in regulating the maturation of phagosomes to lysosomes (PubMed:26989253). Regulates actin dynamics in motor neurons by inhibiting the GTP-binding activity of ARF6, leading to ARF6 inactivation (PubMed:27723745). This reduces the activity of the LIMK1 and LIMK2 kinases which are responsible for phosphorylation and inactivation of cofilin, leading to cofilin activation (PubMed:27723745). Positively regulates axon extension and axon growth cone size in spinal motor neurons (PubMed:27723745). Plays a role within the hematopoietic system in restricting inflammation and the development of autoimmunity (PubMed:27412785).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.