Chtop (NM_023215) Mouse Untagged Clone
CAT#: MC210383
Chtop (untagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik), (10ug)
"NM_023215" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Chtop |
Synonyms | 2500003M10Rik; Fop; Srag |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210383 representing NM_023215
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGAAGAACAAACAGCCGATGCCAGTGAATATTCGGGCTTCGATGCAGCAGCAGCAGCAGCTAGCCA GTGCCAGAAACAGAAGACTGGCCCAGCAGATGGAGAATAGACCCTCTGTCCAGGCAGCATTAAAACTTAA GCAGAAGAGCTTAAAGCAGCGCCTGGGTAAGAGTAATATCCAGGCACGGTTAGGCCGACCCATAGGTGCC CTGGCCAGGGGAGCAATTGGAGGAAGAGGCCTACCCATAATCCAGAGAGGCTTGCCCCGAGGAGGACTAC GTGGGGGACGTGCTACCAGAACCCTGCTTAGGGGTGGGATGTCGCTCCGAGGTCAAAACCTGCTCCGAGG TGGACGAGCCGTAGCTCCCCGAATGGGCTTAAGAAGAGGTGGTGTTCGAGGTCGTGGAGGTCCTGGGAGA GGGGGCCTAGGGCGTGGAGCTATGGGTCGTGGCGGAATCGGTGGTAGAGGTCGGGGTATGATAGGTCGGG GAAGAGGGGGCTTTGGAGGCAGAGGCCGAGGTCGTGGCCGAGGGAGAGGTGCCCTCACTCGCCCTGTATT GACCAAGGAGCAGCTGGACAACCAATTGGATGCATACATGTCGAAAACTAAAGGACACCTGGATGCTGAA TTGGATGCCTACATGGCACAGACAGATCCTGAAACCAATGATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023215 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_023215.6, NP_075704.2 |
RefSeq Size | 3721 bp |
RefSeq ORF | 675 bp |
Locus ID | 66511 |
UniProt ID | Q9CY57 |
Cytogenetics | 3 F1 |
Gene Summary | Plays an important role in the ligand-dependent activation of estrogen receptor target genes (By similarity). May play a role in the silencing of fetal globin genes (PubMed:20688955). Recruits the 5FMC complex to ZNF148, leading to desumoylation of ZNF148 and subsequent transactivation of ZNF148 target genes (PubMed:22872859). Required for the tumorigenicity of glioblastoma cells. Binds to 5-hydroxymethylcytosine (5hmC) and associates with the methylosome complex containing PRMT1, PRMT5, MEP50 and ERH. The CHTOP-methylosome complex associated with 5hmC methylates H4R3 and transactivates genes involved in glioblastomagenesis (PubMed:25284789).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Variants 3 and 8 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222783 | Chtop (tGFP-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik), (10ug) |
USD 500.00 |
|
MR222783 | Chtop (Myc-DDK-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) |
USD 300.00 |
|
MR222783L3 | Lenti ORF clone of Chtop (Myc-DDK-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) |
USD 600.00 |
|
MR222783L4 | Lenti ORF clone of Chtop (mGFP-tagged) - Mouse RIKEN cDNA 2500003M10 gene (2500003M10Rik) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review