Defb4 (NM_019728) Mouse Untagged Clone
CAT#: MC210069
Defb4 (untagged) - Mouse defensin beta 4 (Defb4), (10ug)
"NM_019728" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Defb4 |
Synonyms | 2310001F05Rik; BD-4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210069 representing NM_019728
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGATCCATTACCTTCTCTTCACATTTCTCCTGGTGCTGCTGTCTCCACTTGCAGCCTTTACCCAAA TTATCAACAATCCAATAACATGCATGACCAATGGAGCCATATGCTGGGGTCCGTGCCCTACCGCTTTTCG ACAGATTGGCAATTGTGGCCATTTTAAAGTCAGATGCTGTAAGATAAGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019728 |
Insert Size | 192 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019728.4, NP_062702.1 |
RefSeq Size | 458 bp |
RefSeq ORF | 192 bp |
Locus ID | 56519 |
UniProt ID | P82019 |
Cytogenetics | 8 A1.3 |
Gene Summary | Exhibits antimicrobial activity against Gram-negative bacteria and Gram-positive bacteria. May act as a ligand for C-C chemokine receptor CCR6. Can bind to mouse (but not human) CCR6 and induce chemotactic activity of CCR6-expressing cells (PubMed:20068036).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222346 | Defb4 (tGFP-tagged) - Mouse defensin beta 4 (Defb4), (10ug) |
USD 350.00 |
|
MR222346 | Defb4 (Myc-DDK-tagged) - Mouse defensin beta 4 (Defb4) |
USD 150.00 |
|
MR222346L3 | Lenti ORF clone of Defb4 (Myc-DDK-tagged) - Mouse defensin beta 4 (Defb4) |
USD 450.00 |
|
MR222346L4 | Lenti ORF clone of Defb4 (mGFP-tagged) - Mouse defensin beta 4 (Defb4) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review