Gfi1 (NM_010278) Mouse Untagged Clone

CAT#: MC208542

Gfi1 (untagged) - Mouse growth factor independent 1 (Gfi1), (10ug)


  "NM_010278" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gfi1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gfi1
Synonyms AW495828; Gfi-1; Pal-1; Pal1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NM_010278.2
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGCGCTCATTCCTGGTCAAGAGCAAGAAGGCGCACAGCTATCACCAGCCGCGTTCTCCGGGGCCGG
ACTACTCCCTGCGCCTGGAGACCGTGCCTGCGCCGGGCAGAGCAGAGGGCGGCGCTGTGAGTGCAGGCGA
GTCGAAAATGGAGCCCCGAGAGCGTTTGTCCCCCGACTCTCAGCTTACCGAGGCTCCCGACAGGGCCTCC
GCGTCCCCCAACAGCTGCGAAGGCAGCGTTTGTGACCCCTGCTCCGAGTTCGAGGACTTTTGGAGGCCCC
CTTCTCCCTCCGTGTCTCCAGCGTCGGAGAAGTCACTGTGCCGCTCTCTGGACGAAGCCCAGCCCTACAC
GCTGCCTTTCAAGCCCTATGCATGGAGCGGTCTTGCTGGGTCTGACCTGCGGCACCTGGTGCAGAGCTAT
CGGCAGTGCAGCGCGCTGGAGCGCAGCGCGGGCCTGAGCCTCTTCTGCGAGCGCGGCTCGGAGCCGGGCC
GCCCGGCAGCGCGCTACGGCCCCGAGCAGGCTGCGGGCGGAGCCGGTGCGGGACAGCCAGGGAGCTGCGG
GGTCGCCGGGGGCGCCACCAGCGCTGCGGGCCTGGGGCTCTACGGCGACTTCGCGCCTGCGGCGGCCGGG
CTGTACGAGCGGCCGAGCACAGCAGCAGGCCGGCTGTACCAAGATCATGGCCACGAGCTGCACGCGGACA
AGAGCGTGGGCGTCAAGGTGGAGTCGGAGCTGCTTTGCACCCGTCTGCTGCTGGGCGGCGGCTCCTACAA
ATGCATCAAATGCAGCAAGGTGTTCTCCACACCGCACGGGCTGGAGGTGCACGTGCGCCGGTCCCACAGC
GGCACAAGACCCTTTGCGTGCGAGATGTGCGGCAAGACCTTCGGGCACGCGGTGAGCCTGGAGCAACACA
AGGCAGTGCACTCCCAGGAACGCAGCTTTGACTGTAAGATCTGTGGCAAGAGCTTCAAGAGGTCATCCAC
GCTGTCCACACATCTGCTCATTCACTCGGACACCCGGCCCTATCCCTGTCAGTACTGTGGCAAAAGATTC
CACCAGAAGTCAGATATGAAGAAACACACCTTCATCCACACAGGTGAGAAGCCCCACAAATGCCAGGTGT
GCGGCAAAGCCTTCAGTCAGAGCTCCAACCTCATCACTCATAGCAGAAAGCACACAGGCTTCAAGCCCTT
TGGCTGTGACCTGTGTGGGAAGGGCTTCCAGAGGAAGGTGGATCTCAGGAGGCACCGAGAGACTCAGCAT
GGACTCAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010278
Insert Size 1272 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010278.2, NP_034408.1
RefSeq Size 2862 bp
RefSeq ORF 1272 bp
Locus ID 14581
UniProt ID P70338
Cytogenetics 5 52.23 cM
Gene Summary Transcription repressor essential for hematopoiesis. Functions in a cell-context and development-specific manner. Binds to 5'-TAAATCAC[AT]GCA-3' in the promoter region of a large number of genes. Component of several complexes, including the EHMT2-GFI1-HDAC1, AJUBA-GFI1-HDAC1 and RCOR-GFI-KDM1A-HDAC complexes, that suppress, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development. Regulates neutrophil differentiation, promotes proliferation of lymphoid cells, and is required for granulocyte development. Mediates, together with U2AF1L4, the alternative splicing of CD45 and controls T-cell receptor signaling. Regulates the endotoxin-mediated Toll-like receptor (TLR) inflammatory response by antagonizing RELA. Cooperates with CBFA2T2 to regulate ITGB1-dependent neurite growth. Controls cell-cycle progression by repressing CDKNIA/p21 transcription in response to TGFB1 via recruitment of GFI1 by ZBTB17 to the CDKNIA/p21 and CDKNIB promoters. Required for the maintenance of inner ear hair cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.