St3gal1 (NM_009177) Mouse Untagged Clone

CAT#: MC208043

St3gal1 (untagged) - Mouse ST3 beta-galactoside alpha-2,3-sialyltransferase 1 (St3gal1), (10ug)


  "NM_009177" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "St3gal1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol St3gal1
Synonyms 5330418N22Rik; AI467004; Siat4; Siat4a; St3gal-1; ST3GalI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208043 representing NM_009177
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGAGGAAGACCCTCAAGTACCTCACCTTCTTCCTGCTCTTCATCTTCCTCACTTCCTTTGTCCTGA
ATTACTCCAACACGGGAGTACCCAGTGCCTGGTTCCCCAAGCAGATGCTCCTGGAACTCTCAGAGAACTT
CCGCAGGTTCATCAAGTCACAGCCGTGCACCTGCAGACACTGCATCAGCCAGGACAAGGTATCATATTGG
TTCGACCAGCGCTTCAACAAGACTATGCAGCCCCTGCTGACAGTCCACAACGCTCTGATGGAGGAGGACA
CATACCGGTGGTGGCTGAGGCTCCAGCGGGAGAGGAAACCCAACAACCTGAGCGACACCGTCAAGGAACT
GTTTCGCCTGGTGCCTGGCAATGTGGATCCTATGTTGAACAAGAGGCTGGTGGGCTGCCGACGCTGTGCA
GTTGTAGGAAACTCCGGTAACCTGAAGGACTCCTCGTATGGGCCTGAGATCGACAGCCATGACTTTGTGC
TGAGGATGAACAAGGCACCCACAGTGGGTTTTGAGGCAGACGTTGGGAGCCGGACCACCCACCATCTCGT
GTATCCTGAGAGCTTCCGGGAGCTGGGAGAGAATGTCAACATGGTCCTGGTCCCCTTCAAGACCACCGAC
CTGCAGTGGGTGATCAGCGCCACCACCACAGGCACCATCACTCACACCTATGTCCCCGTGCCCCCGAAGA
TCAAAGTGAAACAAGAGAAGATCCTGATCTACCACCCAGCCTTCATCAAGTATGTCTTTGACAACTGGCT
TCAGGGCCATGGGCGGTATCCATCGACTGGCATCCTCTCCATCATCTTCTCCATTCATATCTGTGATGAG
GTGGACTTATATGGTTTTGGGGCAGACAGCAAAGGAAATTGGCACCATTACTGGGAGAACAACCCATCAG
CGGGTGCCTTCCGAAAGACGGGGGTTCACGATGGTGACTTCGAGTACAACATCACAACTACCCTGGCAGC
CATCAATAAAATCCGCATCTTCAAGGGGAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_009177
Insert Size 1014 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC084730, AAH84730
RefSeq Size 5784 bp
RefSeq ORF 1014 bp
Locus ID 20442
UniProt ID P54751
Cytogenetics 15 D2
Gene Summary Responsible for the synthesis of the sequence NeuAc-alpha-2,3-Gal-beta-1,3-GalNAc- found on sugar chains O-linked to Thr or Ser and also as a terminal sequence on certain gangliosides. SIAT4A and SIAT4B sialylate the same acceptor substrates but exhibit different Km values.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.