Hmgn1 (NM_008251) Mouse Untagged Clone
CAT#: MC207300
Hmgn1 (untagged) - Mouse high mobility group nucleosomal binding domain 1 (Hmgn1), (10ug)
"NM_008251" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hmgn1 |
Synonyms | HMG-14; Hmg14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207300 representing NM_008251
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCAAGAGGAAGGTTAGCGCGGATGGAGCCGCCAAGGCGGAGCCCAAGCGCCGCTCCGCGAGGCTGT CGGCCAAGCCCGCCCCTGCCAAGGTGGACGCGAAGCCGAAAAAGGCCGCGGGAAAGGATAAAGCATCAGA CAAAAAAGTGCAGATAAAAGGGAAGAGGGGAGCGAAGGGCAAACAGGCTGACGTGGCTGACCAGCAAACC ACAGAGCTGCCTGCAGAAAATGGAGAGACGGAAAACCAGAGTCCAGCCTCTGAAGAAGAGAAAGAAGCTA AGTCCGACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008251 |
Insert Size | 291 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008251.3, NP_032277.3 |
RefSeq Size | 1200 bp |
RefSeq ORF | 291 bp |
Locus ID | 15312 |
UniProt ID | P18608 |
Cytogenetics | 16 56.83 cM |
Gene Summary | Binds to the inner side of the nucleosomal DNA thus altering the interaction between the DNA and the histone octamer. May be involved in the process which maintains transcribable genes in a unique chromatin conformation. Inhibits the phosphorylation of nucleosomal histones H3 and H2A by RPS6KA5/MSK1 and RPS6KA3/RSK2.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200269 | Hmgn1 (tGFP-tagged) - Mouse high mobility group nucleosomal binding domain 1 (Hmgn1) |
USD 350.00 |
|
MR200269 | Hmgn1 (Myc-DDK-tagged) - Mouse high mobility group nucleosomal binding domain 1 (Hmgn1) |
USD 150.00 |
|
MR200269L3 | Lenti ORF clone of Hmgn1 (Myc-DDK-tagged) - Mouse high mobility group nucleosomal binding domain 1 (Hmgn1) |
USD 450.00 |
|
MR200269L4 | Lenti ORF clone of Hmgn1 (mGFP-tagged) - Mouse high mobility group nucleosomal binding domain 1 (Hmgn1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review