Fcgr4 (NM_144559) Mouse Untagged Clone
CAT#: MC205356
Fcgr4 (untagged) - Mouse Fc receptor, IgG, low affinity IV (Fcgr4), (10ug)
"NM_144559" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fcgr4 |
Synonyms | 4833442P21Rik; CD16-2; FcgammaRIV; Fcgr3a; FcgRIV; Fcrl3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027310
TCCGGATATCTGTGGTGACATTTTCTATCTGCTTCAGCAGCATGTGGCAGCTACTACTACCAACAGCTCT GGTACTTACAGCTTTCTCTGGCATTCAAGCTGGTCTCCAAAAGGCTGTGGTGAACCTAGACCCCAAGTGG GTCAGGGTGCTTGAGGAAGACAGCGTGACCCTCAGATGCCAAGGCACTTTCTCCCCCGAGGACAATTCTA TCAAGTGGTTCCATAACGAAAGCCTCATCCCACACCAGGATGCCAACTATGTCATCCAAAGTGCCAGAGT TAAGGACAGTGGAATGTACAGGTGCCAGACAGCCCTCTCCACGATCAGTGACCCAGTGCAACTAGAGGTC CATATGGGCTGGCTATTGCTTCAGACCACTAAGTGGCTGTTCCAGGAGGGGGACCCCATTCATCTGAGAT GCCACAGTTGGCAAAACAGACCTGTACGGAAGGTCACCTATTCACAGAACGGCAAAGGCAAGAAGTATTT CCATGAAAATTCTGAATTACTCATTCCAAAAGCTACACACAATGACAGTGGCTCCTACTTCTGCAGAGGG CTCATTGGACACAACAACAAATCTTCAGCATCCTTTCGTATAAGCCTAGGCGATCCAGGGTCTCCATCCA TGTTTCCACCGTGGCATCAAATCACATTCTGCCTGCTGATAGGACTCTTGTTTGCAATAGACACAGTGCT GTATTTCTCTGTGCGGAGGGGTCTTCAAAGTCCTGTGGCTGACTATGAGGAACCCAAGATTCAATGGAGC AAGGAACCTCAGGACAAGTGAGCTCTTATCGCATGCGATGATAAGAGCAATGGTGTAGAACCCATGAGCC TCCCTGGGAGCTTGCAACCTCACCAGCTGCATTGGTCACCATGCTTTGAGCAGCAGAAATAATACAAAGG CCCCTTCCCCAACTGTTTTTTGTTTGTTTGTTTGTTTGTTTTGTTTTGTTTTTTGGTGTTGTATGTTCAT TTGTTTGTTTGTTTGTCTCTCTCCAGTGGACTATCTCAGGGGAAAGGGAAAGCCTGAGGTCTTCAAGGAC CAACAGTGATACAGCAATGCGCACGCAGCTACCCTCCCAAGAAGCGATTCTTCAGAATTTTACACTTTCT CTGCCCCAAACATTCCATTAGAGCAAAGCAGCAGCCTGGACTCTGGGTGGCGATGGCGATCCTTTCCGTG CTTAGCCATTGCTCCTAAATAAACTTCTGTCGAAAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_144559 |
Insert Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027310, AAH27310 |
RefSeq Size | 1304 bp |
RefSeq ORF | 750 bp |
Locus ID | 246256 |
UniProt ID | A0A0B4J1G0 |
Cytogenetics | 1 78.53 cM |
Gene Summary | Receptor for the Fc region of immunoglobulin gamma (PubMed:16039578). Also acts as a receptor for the Fc region of immunoglobulin epsilon (PubMed:17558411, PubMed:18949059). Binds with intermediate affinity to both IgG2a and IgG2b (PubMed:16039578, PubMed:17558411, PubMed:19795417). Can bind to IgG2a and IgG2b monomers (PubMed:18949059). Does not display binding to IgG1 or IgG3 (PubMed:16039578). Mediates neutrophil activation by IgG complexes redundantly with Fcgr3 (PubMed:18097064). Plays a role in promoting bone resorption by enhancing osteoclast differentiation following binding to IgG2a (PubMed:25824719). Binds with low affinity to both the a and b allotypes of IgE (PubMed:18949059). Has also been shown to bind to IgE allotype a only but not to allotype b (PubMed:17558411). Binds aggregated IgE but not the monomeric form and bound monomeric IgG is readily displaced by IgE complexes (PubMed:18949059). Binding to IgE promotes macrophage-mediated phagocytosis, antigen presentation to T cells, production of proinflammatory cytokines and the late phase of cutaneous allergic reactions (PubMed:17558411, PubMed:18949059).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203178 | Fcgr4 (tGFP-tagged) - Mouse Fc fragment of IgG, low affinity IIIa, receptor (Fcgr3a) |
USD 500.00 |
|
MR203178 | Fcgr4 (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IV (Fcgr4) |
USD 300.00 |
|
MR203178L3 | Lenti ORF clone of Fcgr4 (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IV (Fcgr4) |
USD 600.00 |
|
MR203178L4 | Lenti ORF clone of Fcgr4 (mGFP-tagged) - Mouse Fc receptor, IgG, low affinity IV (Fcgr4) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review