Chmp4b (NM_029362) Mouse Untagged Clone

CAT#: MC203574

Chmp4b (untagged) - Mouse chromatin modifying protein 4B (Chmp4b), (10ug)


  "NM_029362" in other vectors (3)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CHMP4B Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Chmp4b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Chmp4b
Synonyms 2010012F05Rik; C76846; Snf7-2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC059279
GGAGGCGAGGCCTGCGGCTGCGGGGAGCGGCAGGCCGGGAGTGGGCGCGGGAGCCGAGCCGAGCCGAGCC GGAGTGGGCGCCGGAGGCCGGCGCGGCGAGCAGCAACCATGTCGGTGTTCGGGAAGCTGTTCGGGGCTGG AGGGGGTAAGGCGGGCAAGGGCGGCCCGACCCCCCAGGAGGCCATCCAGCGGCTTCGGGACACGGAGGAG ATGTTAAGCAAGAAGCAGGAGTTCCTGGAGAAGAAAATCGAACAGGAGCTGACGGCTGCCAAGAAGCACG GCACCAAAAATAAGCGCGCCGCCCTGCAGGCTCTGAAGCGCAAGAAGAGGTATGAGAAGCAGCTGGCACA AATTGATGGCACCCTGTCAACCATCGAGTTCCAGCGGGAGGCCCTAGAGAACGCCAACACCAACACGGAG GTGCTCAAGAACATGGGCTATGCCGCCAAGGCCATGAAGGCTGCCCACGACAACATGGACATTGATAAGG TGGATGAGTTAATGCAGGACATTGCTGACCAGCAAGAACTTGCAGAGGAGATTTCCACAGCTATCTCCAA ACCTGTGGGCTTTGGAGAAGAGTTCGACGAGGATGAGCTCATGGCAGAGTTGGAGGAACTTGAACAAGAG GAGTTGGACAAGAATTTGTTGGAGATCAGTGGGCCCGAAACAGTCCCTCTACCAAATGTCCCCTCCGTAG CCCTACCATCCAAACCCGCCAAGAAGAAGGAAGAGGAAGATGACGACATGAAGGAATTGGAGAACTGGGC CGGATCCATGTAACTGTTCCAGCAGAGGCTGGGCCCAGACGGACTCTGGTGGCCTGTGCATCGGGCAGGC ATGTGCGTGCGCAGGGCAGGCAGGACGCGGTGCAGGCAGCCTCCATCGCTCAGCTCTCACCCAAAGCAGT AGCCGCGCCACTGCTCACTCTCGCATGGCATGGTCTGTGCCCAGGGGTGGGGGGGGGGAGGGGGCGGGGG GAGGTGCCTGCTGTTTATAATGTTGAATTTCTGTAAAATAAACTGTATTTGCAAATCCAACACTGAGTTG CTGGGCTGCGCTAAGCCCACTGCTGCGTCCTCTGTGGAGGGTCGGCCGTTTGCAGTTGAAGCGAACTGGA AATGTAGCCCTGCAGCTGACGTGTCTCACTCTGTAAGACGTGTACGGTACTGGCAGAAAAGTCGTTTTTT AAAAGCCATAGATAGGCTTTTCCTTGTTCTTAGCTGTAATAACACATCTAGTTTTGGTTCCCTCAAGAGC TGTGTTTCTGTCTGTCACCTGTGTACTGGCCCTATGTCTACCATCCTGGCCCTTGTCACTCCTGTCCCCC CTGGTCTTTTGGAGTTTGTGACACGATCTGAAATGGATGTGTTCTCTTGCAAGCGAATAAGATTGTTAGA GTTAATTCCAGCTATCCAGTTTTCTAACGTAGCTCTAAGGTCCTCATTGCTGTTGTGATAATTGATACAT AGCTCATTGGAAACGTGTGCATACATTTATATTCAGATGAAATTATGGTTTGCACCGTCTATTAAATATC TCGATTTAATTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_029362
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC059279, AAH59279
RefSeq Size 1581 bp
RefSeq ORF 675 bp
Locus ID 75608
UniProt ID Q9D8B3
Cytogenetics 2 H1
Gene Summary Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis. Together with SPAST, the ESCRT-III complex promotes nuclear envelope sealing and mitotic spindle disassembly during late anaphase. Plays a role in the endosomal sorting pathway. ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. When overexpressed, membrane-assembled circular arrays of CHMP4B filaments can promote or stabilize negative curvature and outward budding. CHMP4A/B/C are required for the exosomal release of SDCBP, CD63 and syndecan.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.