Tesc (NM_021344) Mouse Untagged Clone

CAT#: MC201246

Tesc (untagged) - Mouse tescalcin (Tesc), (10ug)


  "NM_021344" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tesc"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tesc
Synonyms 1010001A17Rik; 2410011K10Rik; TE-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019492 sequence for NM_021344
GGAACCGGCTCCGCGCCGCTGTCCCCGCGTCCCCACCCGGCTCCAGCGCAGCGCAGCCCAGGCAGTCCCC GGCCTGCGTGGGGCGCCCGGGGCCCCGCGGCGCACCATGGGCGCTGCCCACTCGGCGTCCGAGGAGGTGC GGGAGCTCGAGGGCAAGACCGGCTTCTCCTCGGACCAGATAGAGCAGCTGCATCGGAGGTTCAAGCAGCT AAGCGGGGACCAGCCCACCATTCGCAAGGAGAACTTCAACAATGTCCCTGACCTGGAGCTCAACCCGATC CGATCCAAAATCGTCCGTGCCTTCTTCGACAACAGGAACCTGCGAAAGGGATCCAGCGGTCTGGCCGATG AGATCAACTTTGAGGACTTCCTGACTATCATGTCCTACTTCCGGCCCATCGACACCACCCTGGGCGAGGA ACAGGTGGAGCTGTCACGAAAGGAGAAGCTGAAATTTCTGTTTCATATGTATGATTCGGACAGTGACGGC CGCATCACCCTGGAAGAGTATAGAAATGTGGTGGAGGAGCTGCTCTCGGGAAACCCTCACATTGAAAAGG AGTCGGCTCGGTCCATTGCAGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCGTGGGGCAGATGGAACC GGACCAGGTGTACGAGGGGATCACCTTTGAGGACTTCCTGAAGATCTGGCAGGGCATCGACATCGAGACC AAGATGCACATTCGTTTCCTCAACATGGAGACCATCGCCCTCTGCCACTGACCTGCTGCCTGCTGCCCGT GCAAGGGAGGGGGTGGCTGGAAGCTGGGGGTGACCGAGGACGGATGTTCAGCCCTATGCCTGGGCTTCTG TGACAATCAGTAACCCTTCTTCAGTTATCCTCCTCGTGGGGTGTGGTGTGTGGGACTCCGATATTTTTAT CTCTAATGGTGACAATAAAGGTTTCCTAATGAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_021344
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019492, AAH19492
RefSeq Size 957 bp
RefSeq ORF 645 bp
Locus ID 57816
UniProt ID Q9JKL5
Cytogenetics 5 57.84 cM
Gene Summary Functions as an integral cofactor in cell pH regulation by controlling plasma membrane-type Na(+)/H(+) exchange activity. Promotes the maturation, transport, cell surface stability and exchange activity of SLC9A1/NHE1 at the plasma membrane. Promotes the induction of hematopoietic stem cell differentiation toward megakaryocytic lineage. Essential for the coupling of ERK cascade activation with the expression of ETS family genes in megakaryocytic differentiation. Also involved in granulocytic differentiation in a ERK-dependent manner. Inhibits the phosphatase activity of calcineurin.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.