Dyrk3 (NM_145508) Mouse Untagged Clone

CAT#: MC200501

Dyrk3 (untagged) - Mouse dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3), (10ug)


  "NM_145508" in other vectors (4)

Reconstitution Protocol

USD 546.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dyrk3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dyrk3
Synonyms BC006704
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC006704 sequence for NM_145508
AGCGAAGCCAGCAGGTGCGGTGCTGGAGGCGACCCACCGGGCCAACCGCCGCCTCTGTGTCCGCGGGGCG AGCTCGCGATGGGAGGCGCAGCCCGCGATCGCGGGAGGAAGGACGCGGCGCTGCCGGGGGCCGGGCTCCC GCCGCAGCAGCGGAGGTTGGGGGATGGTGTCTATGATACTTTCATGATGATAGATGAAACCAAGGGCCCA CCCTATTCGGACACATTCAGCAACCCCTCTGAAGCACCTGTCTCCAGAAGGCTAAATATTACCACTGAGC CACTCACGAGAGGCCACACTCAGCACTTTGTGAATGGAAGTGAGATGAAGGTGGAACAACTGTTTCAAGA ATTTGGCAACAGAAGATCCAATACTCTCCAGTCAGATGGCATCAGCAACTCGGAAAAGTCTTCTCCGGCT TCTCAGGGGAAAAGTTCAGAAAGCCTGAGCGCGGTGAAGTGCAACCTTTCCTCCAGGCCGTCTAAGGTGC TGCCGCTGACTCCTGAGCAAGCGCTGAAGCAGTATAAACACCACCTCACTGCCTACGAGAAGCTGGAGAT CGTCAGCTACCCAGAAATCTACTTTGTGGGTCCGAATGCCAAAAAGCGGCAGGGAGTTATTGGTGGTCCC AATAACGGTGGCTACGACGATGCGGATGGGGCCTATATTCATGTGCCCCGGGACCATCTGGCTTACCGCT ATGAGGTGCTGAAAATCATCGGCAAGGGGAGTTTTGGACAGGTAGCCCGGGTCTATGATCACAAACTTCG GCAGTACGTGGCCCTGAAAATGGTGCGCAATGAGAAACGCTTCCATCGCCAGGCAGCCGAGGAGATCCGG ATCTTGGAGCATCTTAAAAAGCAAGACAAAACTGGTAGCATGAACGTCATCCACATGCTAGAAAGTTTCA CCTTCCGGAACCACGTGTGCATGGCCTTTGAACTGCTAAGCATAGACCTGTATGAGCTTATTAAAAAAAA CAAGTTCCAGGGCTTCAGCGTCCAGTTGGTTCGGAAGTTCGCCCAGTCCATCCTACAGTCCCTGGACGCT CTGCACAAAAACAAGATCATCCACTGCGACCTGAAGCCGGAAAACATTCTCCTGAAACACCACGGCCGAA GCGCCACCAAGGTCATCGACTTTGGCTCCAGCTGCTTCGAGTATCAGAAGCTTTACACGTATATCCAGTC CCGCTTCTACAGAGCCCCAGAGATCATCCTGGGGTGCCGCTACAGCACCCCGATCGACATATGGAGCTTT GGTTGCATCCTTGCAGAACTTTTGACAGGACAGCCCCTGTTCCCTGGAGAGGACGAAGGAGACCAGTTGG CCTGCATGATAGAGTTGCTAGGAATGCCACCGCAGAAACTTCTGGAGCAATCCAAGCGTGCCAAGTACTT TATTAACTCCAAAGGCTTGCCTCGATACTGCTCCGTATCTACCCAGACGGACGGGAGGGTGGTGCTTCTC GGGGGTCGCTCACGCAGGGGTAAAAAGCGAGGCCCGCCAGGCAGCAAAGACTGGGCAACCGCACTGAAGG GCTGTGGTGACTACTTGTTCATAGAGTTTCTGAAACGATGCCTCCAGTGGGACCCCTCTGCCCGCCTCAC CCCGGCTCAAGCATTAAGACATCCTTGGATTAGCAAGTCTACACCCAAACCTCTCACCATGGACAAGGTG CCAGGGAAGCGGGTAGTTAACCCTACAAATGCTTTCCAGGGACTGGGTTCCAAGCTGCCTCCAGTCGTTG GGATAGCCAGTAAGCTTAAAGCTAACCTAATGTCCGAAACCAGTGGTAGTATACCTCTGTGCAGTGTATT GCCAAAGCTGATTAGCTAGTGGACCACTCAGAGACTGATACATATCATATGTATTTTTAATTACCTTGCA AACATGCAAATGGAAAACGGAATAATTGAAGCCCATTCACTGATGGATATGTTTTTGTTAGACTTTTTTT TAACAAGGCAGAACATTTTTATATGACTATAAAAGAACGCTTCAAGGGCTAATGTCAAACCAGCTTGTAT TGGCCATCTGGAGTATACATTAAATGACTTTTTCATAGGTCAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_145508
Insert Size 1761 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC006704, AAH06704
RefSeq Size 2091 bp
RefSeq ORF 1761 bp
Locus ID 226419
UniProt ID Q922Y0
Cytogenetics 1 E4
Gene Summary Dual-specificity protein kinase that promotes disassembly of several types of membraneless organelles during mitosis, such as stress granules, nuclear speckles and pericentriolar material (By similarity). Dual-specificity tyrosine-regulated kinases (DYRKs) autophosphorylate a critical tyrosine residue in their activation loop and phosphorylate their substrate on serine and threonine residues (PubMed:12356771). Acts as a central dissolvase of membraneless organelles during the G2-to-M transition, after the nuclear-envelope breakdown: acts by mediating phosphorylation of multiple serine and threonine residues in unstructured domains of proteins, such as SRRM1 and PCM1 (By similarity). Does not mediate disassembly of all membraneless organelles: disassembly of P-body and nucleolus is not regulated by DYRK3 (By similarity). Dissolution of membraneless organelles at the onset of mitosis is also required to release mitotic regulators, such as ZNF207, from liquid-unmixed organelles where they are sequestered and keep them dissolved during mitosis (By similarity). Regulates mTORC1 by mediating the dissolution of stress granules: during stressful conditions, DYRK3 partitions from the cytosol to the stress granule, together with mTORC1 components, which prevents mTORC1 signaling (By similarity). When stress signals are gone, the kinase activity of DYRK3 is required for the dissolution of stress granule and mTORC1 relocation to the cytosol: acts by mediating the phosphorylation of the mTORC1 inhibitor AKT1S1, allowing full reactivation of mTORC1 signaling (By similarity). Also acts as a negative regulator of EPO-dependent erythropoiesis: may place an upper limit on red cell production during stress erythropoiesis (By similarity). Inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells (By similarity). Promotes cell survival upon genotoxic stress through phosphorylation of SIRT1: this in turn inhibits p53/TP53 activity and apoptosis (PubMed:20167603).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.