Ly6a (NM_010738) Mouse Untagged Clone

CAT#: MC200311

Ly6a (untagged) - Mouse lymphocyte antigen 6 complex, locus A (Ly6a), (10ug)


  "NM_010738" in other vectors (6)

Reconstitution Protocol

USD 225.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-Ly6a Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ly6a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ly6a
Synonyms Ly-6A.2; Ly-6A/E; Ly-6E.1; Sca-1; Sca1; TAP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002070 sequence for NM_010738
CTGAGAGGAAGTTTTATCTGTGCAGCCCTTCTCTGAGGATGGACACTTCTCACACTACAAAGTCCTGTTT GCTGATTCTTCTTGTGGCCCTACTGTGTGCAGAAAGAGCTCAGGGACTGGAGTGTTACCAGTGCTATGGA GTCCCATTTGAGACTTCTTGCCCATCAATTACCTGCCCCTACCCTGATGGAGTCTGTGTTACTCAGGAGG CAGCAGTTATTGTGGATTCTCAAACAAGGAAAGTAAAGAACAATCTTTGCTTACCCATCTGCCCTCCTAA TATTGAAAGTATGGAGATCCTGGGTACTAAGGTCAACGTGAAGACTTCCTGTTGCCAGGAAGACCTCTGC AATGTAGCAGTTCCCAATGGAGGCAGCACCTGGACCATGGCAGGGGTGCTTCTGTTCAGCCTGAGCTCAG TCCTCCTGCAGACCTTGCTCTGATGGTCCTCCCAATGACCTCCACCCTTGTCCTTTTATCCTCATGTGCA ACAATTCTTCCTGGAGCCCTCTAGTGATGAATTATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTG AAATACCATGTTTTGCCTTTATAGCCCCTGCTGGGTAGGTAGGTGCTCTAATCCTCTCTAGGGCTTTCAA GTCTGTACTTCCTAGAATGTCATTTTGTTGTGGATTGCTGCTCATGACCCTGGAGGCACACAGCCAGCAC AGTGAAGAGGCAGAATTCCAAGGTATTATGCTATCACCATCCACACATAAGTATCTGGGGTCCTGCAATG TTCCCACATGTATCCTGAATGTCCCCCTGTTGAGTCCAATAAACCCTTTGTTCTCCCAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI     
ACCN NM_010738
Insert Size 405 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002070, AAH02070
RefSeq Size 842 bp
RefSeq ORF 405 bp
Locus ID 110454
UniProt ID P05533
Cytogenetics 15 34.29 cM
Gene Summary T-cell activation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, 5, and 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.