UGT1A8 (NM_019076) Human 3' UTR Clone

CAT#: SC209428

3' UTR clone of UDP glucuronosyltransferase 1 family polypeptide A8 (UGT1A8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT1A8
• Synonyms: GNT1; hUG-BR1; UDPGT; UDPGT 1-1; UDPGT 1-8; UGT-1A; UGT-1H; UGT1; UGT1-01; UGT1-08; UGT1.1; UGT1.8; UGT1A; UGT1A1; UGT1A8S; UGT1H
• ACCN: NM_019076
• Insert Size: 771 bp
• Sequence Data:
  Insert Sequence

  >SC209428 3’UTR clone of NM_019076
  The sequence shown below is from the reference sequence of NM_019076. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AAGAAAGCCCACAAATCCAAGACCCATTGAGAAGTGGGTGGGAAATAAGGTAAAATTTTGAACCATTCC
  CTAGTCATTTCCAAACTTGAAAACAGAATCAGTGTTAAATTCATTTTATTCTTATTAAGGAAATACTTT
  GCATAAATTAATCAGCCCCAGAGTGCTTTAAAAAATTCTCTTAAATAAAAATAATAGACTCGCTAGTCA
  GTAAAGATATTTGAATATGTATCGTGCCCCCTCTGGTGTCTTTGATCAGGATGACATGTGCCATTTTTC
  AGAGGACGTGCAGACAGGCTGGCATTCTAGATTACTTTTCTTACTCTGAAACATGGCCTGTTTGGGAGT
  GCGGGATTCAAAGGTGGTCCCACGGCTGCCCCTACTGCAAATGGCAGTTTTAATCTTATCTTTTGGCTT
  CTGCAGATGGTTGCAATTGATCCTTAACCAATAATGGTCAGTCCTCATCTCTGTCGTGCTTCATAGGTG
  CCACCTTGTGTGTTTAAAGAAGGGAAGCTTTGTACCTTTAGAGTGTAGGTGAAATGAATGAATGGCTTG
  GAGTGCACTGAGAACAGCATATGATTTCTTGCTTTGGGGAAAAAGAATGATGCTATGAAATTGGTGGGT
  GGTGTATTTGAGAAGATAATCATTGCTTATGTCAAATGGAGCTGAATTTGATAAAAACCCAAAATACAG
  CTATGAAGTGCTGGGCAAGTTTACTTTTTTTCTGATGTTTCCTACAACTAAAAATAAATTAATAAATTT
  ATATAAATTCTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_019076.5
• Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]
• Locus ID: 54576
• MW: 28.9