DDX23 (NM_004818) Human 3' UTR Clone

CAT#: SC209371

3' UTR clone of DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 (DDX23) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DDX23
• Synonyms: prp28; PRPF28; SNRNP100; U5-100K; U5-100KD
• ACCN: NM_004818
• Insert Size: 743 bp
• Sequence Data:
  Insert Sequence

  >SC209371 3’UTR clone of NM_004818
  The sequence shown below is from the reference sequence of NM_004818. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AAGCGCCGGGAAGAGACCATCTTTGCCTGACACAGCACTCTTCCTGTGGGCTGAGGGCATCTCCAAAGC
  TGCCTGATGCCTGTTTTTCAGAACCCTCACATCCCTCTTTCCAGGTCCTCACTCTTGGGATATGGGGGC
  TTAGGAAAACAATCCAACTCCCTAGCCCAGACCCTCAGGTCAGGAGGCCTGCGTGTGGGGCTGCAAAAG
  GAGAGGACGACGCTGTCGGAGGCAGGGAGAGCAAATTACCACAGCTTCTTGGCCCAGTTCTGCCCTTCT
  TTGCTTTGGGATTGCACTGGGCCATCAGCTCATGCCAGGCTATGGGGGCAGCCAGTTGGCATTGCTCCC
  CAGACTGAACAGAAACCTGGCCGCCGGATGGGACCTCCTTTGGCACAGACTTGACTGTGTAACTGCATA
  AACTGCAGTAGCATCATTGCCCTAGATGCCCCAGGAGACCTGGCACCATGAGGATTACAGACAGTGGAA
  TCTTACTGTCATCTGGACAGCTGTTTTCCTGTTTGGATGGTAAAGGAAGTTGAGAGTCTTTAGACCTGT
  GCACAGCCCCGCACCAAGGGGTGCTGTATGCTCTAGGCATCCCCTCCCCCAGGGGATTTTCTAAGTAGA
  TGGGGGGACACGGTGAACTGGCTGTGTCCATCTTTGTCACTGAGTGAAATCTCTGTTTTCTATTCTCTG
  AGAAGATAAGTTTGTATGTTCTGAGAATAAATACATGAATATTAAGACTGTTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004818.3
• Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
• Locus ID: 9416
• MW: 27.2