RPA34 (RPA2) (NM_002946) Human 3' UTR Clone

CAT#: SC208438

3' UTR clone of replication protein A2 32kDa (RPA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPA2
• Synonyms: REPA2; RP-A p32; RP-A p34; RPA32
• ACCN: NM_002946
• Insert Size: 669 bp
• Sequence Data:
  Insert Sequence

  >SC208438 3’UTR clone of NM_002946
  The sequence shown below is from the reference sequence of NM_002946. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GACCATTTTAAATCCACAGATGCAGAATAACTGGATCTAACTGGGTACCTGAGATATTTTACAGCTGGA
  CCTAGTTTCACAATCTGTTGTCTCCAGCTCTGCATATGTCTGGCCAGGGGGCTTCTAGGAAGTAGGTTT
  CATCTATCAAATGTCTCCTCTGACTTCCTTTTGAAACTTACTGCTCTTCTGTTTTATTTTGTTTTGTTT
  GAAGCTCAGAGGGAGATGGGCAATTGACAGGGATGCAATCCAGGGTGGGATTTCTTGAGGAAGTTACAA
  ATAAGCTTGTTACAACATCAAGATAGATGGAATTGGAAGGATGCTACCAGGAGAGTACTTACATAGTGC
  TCAGGAGTTTCTCTTCTTAAAATGTTTACTGCTGAAAGATGAGCAGGACCAGGGCGTTATAGGCAGAGC
  CCTAGCCGAGAAACCTGCTGGCCTCTGCCTGTTTTCATTTCCCACTTTGGTTGTGTGGCATTACTTTCA
  GAATTGCACTTTCCTGCTTGTCATGACTTTTTGACACACTTGCCATGACGTGTGTTTCTGTGAACATGA
  AGTTCTGCGGTAGTGCCTCCAGGGGCAGAGGAAAAGAAGAAGTGTTACTGCATTTTGTACAAAATAAAT
  ACAGTCATATGTTTAATAAAACAGTTCTATTGTAGTAACTTGTAAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002946.5
• Summary: This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017]
• Locus ID: 6118
• MW: 25.5