MARK3 (NM_002376) Human 3' UTR Clone

CAT#: SC208183

3' UTR clone of MAP/microtubule affinity-regulating kinase 3 (MARK3) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "MARK3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MARK3
Synonyms CTAK1; KP78; Par-1a; PAR1A; VIPB
ACCN NM_002376
Insert Size 634 bp
Sequence Data
>SC208183 3’UTR clone of NM_002376
The sequence shown below is from the reference sequence of NM_002376. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAAAATTGCCAATGAGCTAAAGCTGTAACCCAGTGATTATGATGTAAATTAAGTAGCAATTAAAGTG
TTTTCCTGAACACTGATGGAAATGTATAGAATAATATTTAGGCAATAACGTCTGCATCTTCTAAATCAT
GAAATTAAAGTCTGAGGACGAGAGCACGCCTGGGAGCGAAAGCTGGCCTTTTTTCTACGAATGCACTAC
ATTAAAGATGTGCAACCTATGCGCCCCCTGCCCTACTTCCGTTACCCTGAGAGTCGGTGTGTGGCCCCA
TCTCCATGTGCCTCCCGTCTGGGTGGGTGTGAGAGTGGACGGTATGTGTGTGAAGTGGTGTATATGGAA
GCATCTCCCTACACTGGCAGCCAGTCATTACTAGTACCTCTGCGGGAGATCATCCGGTGCTAAAACATT
ACAGTTGCCAAGGAGGAAAATACTGAATGACTGCTAAGAATTAACCTTAAGACCAGTTCATAGTTAATA
CAGGTTTACAGTTCATGCCTGTGGTTTTGTGTTTGTTGTTTTGTGTTTTTTTAGTGCAAAAGGTTTAAA
TTTATAGTTGTGAACATTGCTTGTGTGTGTTTTTCTAAGTAGATTCACAAGATAATTAAAAATTCACTT
TTTCTCAGTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002376.7
Summary The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 4140
MW 24.7

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.