KHDRBS3 (NM_006558) Human 3' UTR Clone

CAT#: SC207096

3' UTR clone of KH domain containing RNA binding signal transduction associated 3 (KHDRBS3) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "KHDRBS3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KHDRBS3
Synonyms Etle; etoile; SALP; SLM-2; SLM2; T-STAR; TSTAR
ACCN NM_006558
Insert Size 556 bp
Sequence Data
>SC207096 3’UTR clone of NM_006558
The sequence shown below is from the reference sequence of NM_006558. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAGAGACCAGCCATATGGCAGATACTGATTGTACTGTCTGATGTTGTGAAATAGCCAATCTCCACCA
GTCCTGTATACTGTTCAAAGTAATTTTTTTCTATGAACAATCCCTTTTTAAATAAATCAGAATGCTTAA
AATCTGAATGGATGGAACTTAAAACTACTTTGTTGAAACATCAACCTGGGCAGAAAAAAAAAAAAAAAG
ACATGTAAAATTTTGTTATTTCCAGTCTGTATATGAAAAAATAGGTCATCAAAAGGAAAAAAAATAACT
TTGATTAACTAGTGTTAAACAAAAAATAGGTTTACTAAATATGTTAATCTATTCTTTTAACATAAGCCT
CACCTTTCATTTTAAAGGTTTCCATAGAATTTAGTTATTTTATCTTTCAGCCATATGCTAGTTTTTTTT
TCTCTTGCCAACATGCGTAAAAAGGGAAGCCAATTACAAGTGCAAATAATGTGGTATTCTTTTGTAACT
CAAGTCTTGAAATGTTCTGTAGTGTTAAGCAAAGTCTCCTCTTGCTTGATACTAAATAAACTTTTGAAA
GAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006558.3
Summary RNA-binding protein that plays a role in the regulation of alternative splicing and influences mRNA splice site selection and exon inclusion. Binds preferentially to the 5'-[AU]UAAA-3' motif in vitro. Binds optimally to RNA containing 5'-[AU]UAA-3' as a bipartite motif spaced by more than 15 nucleotides. Binds poly(A). RNA-binding abilities are down-regulated by tyrosine kinase PTK6 (PubMed:10564820, PubMed:19561594, PubMed:26758068). Involved in splice site selection of vascular endothelial growth factor (PubMed:15901763). In vitro regulates CD44 alternative splicing by direct binding to purine-rich exonic enhancer (By similarity). Can regulate alternative splicing of neurexins NRXN1-3 in the laminin G-like domain 6 containing the evolutionary conserved neurexin alternative spliced segment 4 (AS4) involved in neurexin selective targeting to postsynaptic partners such as neuroligins and LRRTM family members (PubMed:26758068). Targeted, cell-type specific splicing regulation of NRXN1 at AS4 is involved in neuronal glutamatergic synapse function and plasticity (By similarity). May regulate expression of KHDRBS2/SLIM-1 in defined brain neuron populations by modifying its alternative splicing (By similarity). Can bind FABP9 mRNA (By similarity). May play a role as a negative regulator of cell growth. Inhibits cell proliferation.[UniProtKB/Swiss-Prot Function]
Locus ID 10656
MW 21.7

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.