SLC25A6 (NM_001636) Human 3' UTR Clone

CAT#: SC206352

3' UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 6 (SLC25A6) nuclear gene encoding mitochondrial protein for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "SLC25A6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC25A6
Synonyms AAC3; ANT; ANT 2; ANT 3; ANT3; ANT3Y
ACCN NM_001636
Insert Size 480 bp
Sequence Data
>SC206352 3’UTR clone of NM_001636
The sequence shown below is from the reference sequence of NM_001636. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGTACGACGAGCTCAAGAAGGTGATCTAAGGGCCGCGGCCTCCTCCACACACACACACACACCAGGGG
AACCAAGAGAACCACGTAGAATCCTCAACCGTGCGGACCATCAACCTTCGAGAAATTCCAGTTGTCTTT
TTCCCAGCCGCATCCTGCCTGTAGATGGCCGGGGAAGGCTCTAGAAAAGGGGCGCATTGCGATCCAACC
ATCGGCAGCCGATTCCGTGTCTTGATCACGGGGTGGGAGGGAACCGTGGCGTCCCTGCGTGGGGCCCAT
GGGTGAGACACTCCAGTACTGAGACCTAGAGTCCAGATGCTTGTAGGAGCCAAGTCGTGTTCTAAGTAT
TTATTTAAAACAAAAGAATCACGTTTTCCCATTTGTACTTCAGCGCTAGCCCCTGTTTTGCACAGCCGA
GTACTGGCGAGTATGTTCTATGTTGGGCCTCCTGCTGCAAAACAATAAACAGAGGACGCAGAGGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001636.4
Summary This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013]
Locus ID 293
MW 17.5

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.