Glutathione Synthetase (GSS) (NM_000178) Human 3' UTR Clone

CAT#: SC205551

3' UTR clone of glutathione synthetase (GSS) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GSS
Synonyms GSHS; HEL-S-64p; HEL-S-88n
ACCN NM_000178
Insert Size 403 bp
Sequence Data
>SC205551 3' UTR clone of NM_000178
The sequence shown below is from the reference sequence of NM_000178. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTGGCAGTCCTGGACAACCCATACCCTGTGTGAGGGCACAACCAGGCCACGGGACCTTCTATCCTCTGT
ATTTGTCATTCCTCTCCTAGCCCTCCTGAGGGGTATCCTCCTAAAGACCTCCAAAGTTTTTATGGAAGGG
TAAATACTGGTACCTTCCCCCAGCTTTCCATCTGAGGACCAGAAAAGTTGTGTCTCCCTTAGATGAGATC
TAGACGCCCCCAAATCCTTGAGATGTGGGTATAGCTCAGGGTAAGCTGCTCTGAGGTAAAGGTCCATGAA
CCCTGCCCCACTCCTGTCAGCCCCTCATCAGCCTTTTCAGCAGGTTCCAGTGCCTGACTTGGGATAGGAC
TGAGTGGTAGGAGGAGGGGGAGTGGAGGGGCATAGCCTTTCCCTAATTCTGCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000178.2
Summary Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
Locus ID 2937

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.