DYRK1B (NM_006483) Human 3' UTR Clone

CAT#: SC204976

3' UTR clone of dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B (DYRK1B) transcript variant b for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DYRK1B
• Synonyms: AOMS3; MIRK
• ACCN: NM_006483
• Insert Size: 395 bp
• Sequence Data:
  Insert Sequence

  >SC204976 3’UTR clone of NM_006483
  The sequence shown below is from the reference sequence of NM_006483. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTACCCCAGAGCACAGCAGCCAGCTCGTGACCCTGCCCCCTCCCTGGGGCCCCTCCTGAAGCCATACCC
  TCCCCCATCTGGGGGCCCTGGGCTCCCATCCTCATCTCTCTCCTTGACTGGAATTGCTGCTACCCAGCT
  GGGGTGGGTGAGGCCTGCACTGATTGGGGCCTGGGGCAGGGGGGTCAAGGAGAGGGTTTTGGCCGCTCC
  CTCCCCACTAAGGACTGGACCCTTGGGCCCCTCTCCCCCTTTTTTTCTATTTATTGTACCAAAGACAGT
  GGTGGTCCGGTGGAGGGAAGACCCCCCCTCACCCCAGGACCCTAGGAGGGGGTGGGGGCAGGTAGGGGG
  AGATGGCCTTGCTCCTCCTCGCTGTACCCCCAGTAAAGAGCTTTCTCACA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006483.3
• Summary: This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
• Locus ID: 9149
• MW: 13.6