COP1 (RFWD2) (NM_001001740) Human 3' UTR Clone

CAT#: SC204687

3' UTR clone of ring finger and WD repeat domain 2 (RFWD2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COP1
• Synonyms: CFAP78; FAP78; RFWD2; RNF200
• ACCN: NM_001001740
• Insert Size: 352 bp
• Sequence Data:
  Insert Sequence

  >SC204687 3’UTR clone of NM_001001740
  The sequence shown below is from the reference sequence of NM_001001740. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGTACAATTAAGGTGCTAGAATTGGTATGAAGGGTTAACTCAAGTCAAATTGTACTTGATCCTGCTGAA
  ATACATCTGCAGCTGACAATGAGAGAAGAAACAGAAAATGTCATGTGATGTCTCTCCCCAAAGTCATCA
  TGGGTTTTGGATTTGTTTTGAATATTTTTTTCTTTTTTTCTTTTCCCTCCTTTATGACCTTTGGGACAT
  TGGGAATACCCAGCCAACTCTCCACCATCAATGTAACTCCATGGACATTGCTGCTCTTGGTGGTGTTAT
  CTAATTTTTGTGATAGGGAAACAAATTCTTTTGAATAAAAATAAATAACAAAACAATAAAAGTTTATTG
  AGCCACA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_001001740.4
• Summary: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Involved in JUN ubiquitination and degradation. Directly involved in p53 (TP53) ubiquitination and degradation, thereby abolishing p53-dependent transcription and apoptosis. Ubiquitinates p53 independently of MDM2 or RCHY1. Probably mediates E3 ubiquitin ligase activity by functioning as the essential RING domain subunit of larger E3 complexes. In contrast, it does not constitute the catalytic RING subunit in the DCX DET1-COP1 complex that negatively regulates JUN, the ubiquitin ligase activity being mediated by RBX1. Involved in 14-3-3 protein sigma/SFN ubiquitination and proteasomal degradation, leading to AKT activation and promotion of cell survival. Ubiquitinates MTA1 leading to its proteasomal degradation. Upon binding to TRIB1, ubiquitinates CEBPA, which lacks a canonical COP1-binding motif (Probable).[UniProtKB/Swiss-Prot Function]
• Locus ID: 64326
• MW: 13.5