emopamil binding protein (EBP) (NM_006579) Human 3' UTR Clone

CAT#: SC203820

3' UTR clone of emopamil binding protein (sterol isomerase) (EBP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: emopamil binding protein
• Synonyms: CDPX2; CHO2; CPX; CPXD; MEND
• ACCN: NM_006579
• Insert Size: 289 bp
• Sequence Data:
  Insert Sequence

  >SC203820 3’UTR clone of NM_006579
  The sequence shown below is from the reference sequence of NM_006579. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GCCACAAAAGCCAAGAGCAAGAAGAACTGAGGAGTGGTGGACCAGGCTCGAACACTGGCCGAGGAGGAG
  CTCTCTGCCTGCCAGAAGAGTCTAGTCCTGCTCCCACAGTTTGGAGGGACAAAGCTAATTGATCTGTCA
  CACTCAGGCTCATGGGCAGGCACAAGAAGGGGAATAAAGGGGCTGTGTGAAGGCACTGCTGGGAGCCAT
  TAGAACACAGATACAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAAAATCAGGAAATAAAAG
  ATCTTGACTCTAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_006579.3
• Summary: The protein encoded by this gene is an integral membrane protein of the endoplasmic reticulum. It is a high affinity binding protein for the antiischemic phenylalkylamine Ca2+ antagonist [3H]emopamil and the photoaffinity label [3H]azidopamil. It is similar to sigma receptors and may be a member of a superfamily of high affinity drug-binding proteins in the endoplasmic reticulum of different tissues. This protein shares structural features with bacterial and eukaryontic drug transporting proteins. It has four putative transmembrane segments and contains two conserved glutamate residues which may be involved in the transport of cationic amphiphilics. Another prominent feature of this protein is its high content of aromatic amino acid residues (>23%) in its transmembrane segments. These aromatic amino acid residues have been suggested to be involved in the drug transport by the P-glycoprotein. Mutations in this gene cause Chondrodysplasia punctata 2 (CDPX2; also known as Conradi-Hunermann syndrome). [provided by RefSeq, Jul 2008]
• Locus ID: 10682
• MW: 10.5