RBMY1D (NM_001006120) Human 3' UTR Clone

CAT#: SC203556

3' UTR clone of RNA binding motif protein Y-linked family 1 member D (RBMY1D) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RBMY1D
• Synonyms: hRBMY; RBM1; RBM2; RBMY1A1; YRRM1; YRRM2
• ACCN: NM_001006120
• Insert Size: 308 bp
• Sequence Data:
  Insert Sequence

  >SC203556 3’UTR clone of NM_001006120
  The sequence shown below is from the reference sequence of NM_001006120. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TCTGAAAAAGGAGACTCGAGCAGATATTAAAGCAAGCATTGAAAATAATAGTTATTGCATACCAATCCT
  TGTTTGCAAATCAAAAATTGAAATGTTATTTCTGCATTGTTACCTGCATATTACTGAAAGAAACATGTT
  GGTTTTGTGGAGAGAGGTAGATACTAACTTCCTCCATGAATTTTTTGAGGTATTCAAAGGAAAAGGAAT
  TGTTTTCAAAGTAATTTCATACTTGTTGATGCTATTTGAAAAGTGTTTAGATGTAATATCTACCTTAAA
  ATTTTCACAATAAAATTTGACATGTACTGCAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001006120.3
• Summary: This gene encodes a protein containing an RNA-binding motif in the N-terminus and four SRGY (serine, arginine, glycine, tyrosine) boxes in the C-terminus. This protein likely functions as a splicing factor during spermatogenesis. Multiple closely related paralogs of this gene are found in a gene cluster in the AZFb azoospermia factor region of chromosome Y. Most of these related copies are thought to be pseudogenes, though several likely encode functional proteins. [provided by RefSeq, Mar 2016]
• Locus ID: 378949
• MW: 12