STAT1 (NM_139266) Human 3' UTR Clone

CAT#: SC203451

3' UTR clone of signal transducer and activator of transcription 1 91kDa (STAT1) transcript variant beta for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "STAT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol STAT1
Synonyms CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
ACCN NM_139266
Insert Size 300 bp
Sequence Data
>SC203451 3’UTR clone of NM_139266
The sequence shown below is from the reference sequence of NM_139266. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGAGTTGATTTCTGTGTCTGAAGTGTAAGTGAACACAGAAGAGTGACATGTTTACAAACCTCAAGCC
AGCCTTGCTCCTGGCTGGGGCCTGTTGAAGATGCTTGTATTTTACTTTTCCATTGTAATTGCTATCGCC
ATCACAGCTGAACTTGTTGAGATCCCCGTGTTACTGCCTATCAGCATTTTACTACTTTAAAAAAAAAAA
AAAAGCCAAAAACCAAATTTGTATTTAAGGTATATAAATTTTCCCAAAACTGATACCCTTTGAAAAAGT
ATAAATAAAATGAGCAAAAGTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_139266.3
Summary The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020]
Locus ID 6772
MW 11.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.