NF2 (NM_181831) Human 3' UTR Clone

CAT#: SC203081

3' UTR clone of neurofibromin 2 (merlin) (NF2) transcript variant 13 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NF2
• Synonyms: ACN; BANF; merlin-1; SCH
• ACCN: NM_181831
• Insert Size: 514 bp
• Sequence Data:
  Insert Sequence

  >SC203081 3’UTR clone of NM_181831
  The sequence shown below is from the reference sequence of NM_181831. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GCCCAAGGCAGAAGACCTATCTGCATTTGAGCCCTCAAACTTCCTCTCCATAGGCTGAGCAGAGATGTG
  GTCAGAGTGAACTCACATTGGAACAGTACACTCACGGCACCCTGGAGAGGAGCGGTCACTGGTTGCTGA
  GTGAATTAACCGAATGTTTGCTGCTTTTCTCCTGCAACAGTTCATTATTCCTCCAGCATGCCTAGGCAG
  TGGAGAGAATGTATTTTGCCCAATAATAAAATGACATCCTGCCTCTACTTCTCACCTAATCCCCAGTAG
  TACCCATGCCAACAAGCCCCACACCACCTGACAGCAGCATAGGATGTGTCCTTTGGAGTCTTCCCTGCA
  GTTTCTGCTCATAGAGTGGAATAAGCTCATTGGAACCTTTCTAACAAAAAGAGATCTGGCATAAGATAG
  ATCCTACTTGTGGTCGTTATCCCATCAAGAGAGGTCAGCTGTTAAAGTCCCTGATAGATCTTATTAAAA
  GGTACACTTGAGCTGTCAGTGGTTCCAAGAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_181831.3
• Summary: This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
• Locus ID: 4771
• MW: 19.1