GGT1 (NM_005265) Human 3' UTR Clone

CAT#: SC201966

3' UTR clone of gamma-glutamyltransferase 1 (GGT1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GGT1
• Synonyms: CD224; D22S672; D22S732; GGT; GGT 1; GTG
• ACCN: NM_005265
• Insert Size: 196 bp
• Sequence Data:
  Insert Sequence

  >SC201966 3’UTR clone of NM_005265
  The sequence shown below is from the reference sequence of NM_005265. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AGGAAAGGCGGGGAGCCTGCCGGCTACTGAGTGCTCCAGGAGGACAAGGCTGACAAGCAATCCAGGGAC
  AAGATACTCACCAGGACCAGGAAGGGGACTCTGGGGGACCGGCTTCCCCTGTGAGCAGCAGAGCAGCAC
  AATAAATGAGGCCACTGTGCCAGGCTCCAGGTGGCCTCCCTGGCCTGTCTCCCCACTC
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005265.3
• Summary: The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014]
• Locus ID: 2678
• MW: 7.1