RAD51C (NM_002876) Human 3' UTR Clone

CAT#: SC201518

3' UTR clone of RAD51 homolog C (S. cerevisiae) (RAD51C) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RAD51C
• Synonyms: BROVCA3; FANCO; R51H3; RAD51L2
• ACCN: NM_002876
• Insert Size: 171 bp
• Sequence Data:
  Insert Sequence

  >SC201518 3’UTR clone of NM_002876
  The sequence shown below is from the reference sequence of NM_002876. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CCAGGTGTTGGAAAAACACAATTATGGTAAAATAAAGTGTTCTCCTTTTAAGGGTGGGTTTAATAACAT
  ATTATGAAAGTAGTATTTTGTACTATCGTCAGGAAACCAAATAAGATATATATGTGCTCTTAATTTTAA
  GTGTGTATGTGCATTAAACAAAAATTAGCTTAC
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002876.4
• Summary: This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
• Locus ID: 5889
• MW: 6.7