NDUFS6 (NM_004553) Human 3' UTR Clone

CAT#: SC201294

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 6 13kDa (NADH-coenzyme Q reductase) (NDUFS6) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFS6
• Synonyms: CI-13kA; CI-13kD-A; CI13KDA; MC1DN9
• ACCN: NM_004553
• Insert Size: 162 bp
• Sequence Data:
  Insert Sequence

  >SC201294 3’UTR clone of NM_004553
  The sequence shown below is from the reference sequence of NM_004553. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGGCTCCAGTTCAGACAGCACCACCACTAGAGCGTGTGGCACGCCGGGGGTCCCGCAGCATCCTGTGAG
  CATTTCCGCGGGGAAGCTGAGCACGTGAAGCTCGCTGGTTCTGTGCGAAGGGTATTCCTGGTGCTGAAT
  AAAGGGTGTTGCTGTCAAGGCTGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004553.6
• Summary: This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009]
• Locus ID: 4726
• MW: 5.8