Human BORIS (CTCFL) activation kit by CRISPRa

CAT#: GA115390

CTCFL CRISPRa kit - CRISPR gene activation of human CCCTC-binding factor like

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: CTCFL
• Locus ID: 140690
• Kit Components:

  GA115390G1, BORIS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCTCCCCTAGGTGTCAC

  GA115390G2, BORIS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGGGGGGTGGTGGGTAA

  GA115390G3, BORIS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGGTAGGAGGGCCAAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001269040, NM_001269041, NM_001269042, NM_001269043, NM_001269044, NM_001269045, NM_001269046, NM_001269047, NM_001269048, NM_001269049, NM_001269050, NM_001269051, NM_001269052, NM_001269054, NM_001269055, NM_080618, NR_072975
• UniProt ID: Q8NI51
• Synonyms: BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
• Summary: CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]