Human B7-2 (CD86) activation kit by CRISPRa

CAT#: GA100664

CD86 CRISPRa kit - CRISPR gene activation of human CD86 molecule

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: CD86
• Locus ID: 942
• Kit Components:

  GA100664G1, B7-2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCTCCACACTTTGGTTG

  GA100664G2, B7-2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTTTAAACTCATTGACGT

  GA100664G3, B7-2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGATTTTGACCACACTTG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001206924, NM_001206925, NM_006889, NM_175862, NM_176892
• UniProt ID: P42081
• Synonyms: B7-2; B7.2; B70; CD28LG2; LAB72
• Summary: This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]