CD40L (CD40LG) (NM_000074) Human Untagged Clone

CAT#: SC338162

CD40LG (untagged)-Human CD40 ligand (CD40LG)


  "NM_000074" in other vectors (7)

Reconstitution Protocol

USD 300.00

5 Days*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CD40L mouse monoclonal capture antibody, validated for ELISA and Luminex assays
    • 100 ug

USD 458.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD40L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD40L
Synonyms CD40L; CD154; gp39; hCD40L; HIGM1; IGM; IMD3; T-BAM; TNFSF5; TRAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC338162 representing .
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCGAAACATACAACCAAACTTCTCCCCGATCTGCGGCCACTGGACTGCCCATCAGCATGAAAATT
TTTATGTATTTACTTACTGTTTTTCTTATCACCCAGATGATTGGGTCAGCACTTTTTGCTGTGTATCTT
CATAGAAGGTTGGACAAGATAGAAGATGAAAGGAATCTTCATGAAGATTTTGTATTCATGAAAACGATA
CAGAGATGCAACACAGGAGAAAGATCCTTATCCTTACTGAACTGTGAGGAGATTAAAAGCCAGTTTGAA
GGCTTTGTGAAGGATATAATGTTAAACAAAGAGGAGACGAAGAAAGAAAACAGCTTTGAAATGCAAAAA
GGTGATCAGAATCCTCAAATTGCGGCACATGTCATAAGTGAGGCCAGCAGTAAAACAACATCTGTGTTA
CAGTGGGCTGAAAAAGGATACTACACCATGAGCAACAACTTGGTAACCCTGGAAAATGGGAAACAGCTG
ACCGTTAAAAGACAAGGACTCTATTATATCTATGCCCAAGTCACCTTCTGTTCCAATCGGGAAGCTTCG
AGTCAAGCTCCATTTATAGCCAGCCTCTGCCTAAAGTCCCCCGGTAGATTCGAGAGAATCTTACTCAGA
GCTGCAAATACCCACAGTTCCGCCAAACCTTGCGGGCAACAATCCATTCACTTGGGAGGAGTATTTGAA
TTGCAACCAGGTGCTTCGGTGTTTGTCAATGTGACTGATCCAAGCCAAGTGAGCCATGGCACTGGCTTC
ACGTCCTTTGGCTTACTCAAACTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_000074
Insert Size 786 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reference Data
RefSeq Size 1834 bp
RefSeq ORF 786 bp
Locus ID 959
UniProt ID P29965
Cytogenetics Xq26.3
Domains TNF
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Allograft rejection, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Cytokine-cytokine receptor interaction, Primary immunodeficiency, Systemic lupus erythematosus, T cell receptor signaling pathway, Viral myocarditis
MW 29.3 kDa
Gene Summary The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.