FADS2 (NM_001281501) Human Untagged Clone

CAT#: SC336031

FADS2 (untagged) - Human fatty acid desaturase 2 (FADS2), transcript variant 2


  "NM_001281501" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal FADS2 Antibody (Center)
    • 400 ul

USD 580.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FADS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FADS2
Synonyms D6D; DES6; FADSD6; LLCDL2; SLL0262; TU13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336031 representing NM_001281501.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACGGCAGGGAGGCGGGACCCTTTGTTTGTGTGTGCGTGTTGTTGGCCTCCATCCCCACTCCCCAG
ACTCCACTTCTCCAGGCCTCTCTCCCGCCTTTTCATCCCGCATCCGCAGGACACCCAATCACCGGGCAA
CAGGATGCCTTCCGCGCCTTCCACCCTGACCTGGAATTCGTGGGCAAGTTCTTGAAACCCCTGCTGATT
GGTGAACTGGCCCCGGAGGAGCCCAGCCAGGACCACGGCAAGAACTCAAAGATCACTGAGGACTTCCGG
GCCCTGAGGAAGACGGCTGAGGACATGAACCTGTTCAAGACCAACCACGTGTTCTTCCTCCTCCTCCTG
GCCCACATCATCGCCCTGGAGAGCATTGCATGGTTCACTGTCTTTTACTTTGGCAATGGCTGGATTCCT
ACCCTCATCACGGCCTTTGTCCTTGCTACCTCTCAGGCCCAAGCTGGATGGCTGCAACATGATTATGGC
CACCTGTCTGTCTACAGAAAACCCAAGTGGAACCACCTTGTCCACAAATTCGTCATTGGCCACTTAAAG
GGTGCCTCTGCCAACTGGTGGAATCATCGCCACTTCCAGCACCACGCCAAGCCTAACATCTTCCACAAG
GATCCCGATGTGAACATGCTGCACGTGTTTGTTCTGGGCGAATGGCAGCCCATCGAGTACGGCAAGAAG
AAGCTGAAATACCTGCCCTACAATCACCAGCACGAATACTTCTTCCTGATTGGGCCGCCGCTGCTCATC
CCCATGTATTTCCAGTACCAGATCATCATGACCATGATCGTCCATAAGAACTGGGTGGACCTGGCCTGG
GCCGTCAGCTACTACATCCGGTTCTTCATCACCTACATCCCTTTCTACGGCATCCTGGGAGCCCTCCTT
TTCCTCAACTTCATCAGGTTCCTGGAGAGCCACTGGTTTGTGTGGGTCACACAGATGAATCACATCGTC
ATGGAGATTGACCAGGAGGCCTACCGTGACTGGTTCAGTAGCCAGCTGACAGCCACCTGCAACGTGGAG
CAGTCCTTCTTCAACGACTGGTTCAGTGGACACCTTAACTTCCAGATTGAGCACCACCTCTTCCCCACC
ATGCCCCGGCACAACTTACACAAGATCGCCCCGCTGGTGAAGTCTCTATGTGCCAAGCATGGCATTGAA
TACCAGGAGAAGCCGCTACTGAGGGCCCTGCTGGACATCATCAGGTCCCTGAAGAAGTCTGGGAAGCTG
TGGCTGGACGCCTACCTTCACAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001281501
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281501.1
RefSeq Size 3025 bp
RefSeq ORF 1269 bp
Locus ID 9415
UniProt ID O95864
Cytogenetics 11q12.2
Protein Families Transmembrane
Protein Pathways alpha-Linolenic acid metabolism, Biosynthesis of unsaturated fatty acids, PPAR signaling pathway
MW 49.3 kDa
Gene Summary The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.