Adenosine Receptor A2a (ADORA2A) (NM_001278499) Human Untagged Clone

CAT#: SC335959

ADORA2A (untagged) - Human adenosine A2a receptor (ADORA2A), transcript variant 4


  "NM_001278499" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Adenosine Receptor A2a"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Adenosine Receptor A2a
Synonyms A2aR; ADORA2; RDC8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335959 representing NM_001278499.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGC
AATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTG
TCACTGGCGGCGGCCGACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGG
TTCTGCGCTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCATC
TTCAGTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGTACAATGGCTTG
GTGACCGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGTCGTTTGCCATCGGCCTGACT
CCCATGCTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGGGCAAGAACCACTCCCAGGGCTGCGGGGAG
GGCCAAGTGGCCTGTCTCTTTGAGGATGTGGTCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCC
TGTGTGCTGGTGCCCCTGCTGCTCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAG
CTGAAGCAGATGGAGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCAT
GCTGCCAAGTCACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCATCAAC
TGCTTCACTTTCTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACCTGGCCATCGTCCTC
TCCCACACCAATTCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTC
CGCAAGATCATTCGCAGCCACGTCCTGAGGCAGCAAGAACCTTTCAAGGCAGCTGGCACCAGTGCCCGG
GTCTTGGCAGCTCATGGCAGTGACGGAGAGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTG
TGGGCCAACGGCAGTGCTCCCCACCCTGAGCGGAGGCCCAATGGCTATGCCCTGGGGCTGGTGAGTGGA
GGGAGTGCCCAAGAGTCCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAG
GGAGTGTGCCCAGAGCCCCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278499
Insert Size 1239 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278499.1
RefSeq Size 2563 bp
RefSeq ORF 1239 bp
Locus ID 135
UniProt ID P29274
Cytogenetics 22q11.23
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
MW 44.7 kDa
Gene Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants, 1, 2, 3, 4, and 5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.