GABA A Receptor beta 3 (GABRB3) (NM_001278631) Human Untagged Clone

CAT#: SC335799

GABRB3 (untagged) - Human gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript variant 5


  "NM_001278631" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Mouse Monoclonal Anti-GABA(A) Receptor beta3 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GABA A Receptor beta 3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GABA A Receptor beta 3
Synonyms DEE43; ECA5; EIEE43
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335799 representing NM_001278631.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTATTTTCAACAATATTGGAGAGATAAAAGGCTCGCCTATTCTGGGATCCCTCTCAACCTCACGCTT
GACAATCGAGTGGCTGACCAGCTATGGGTGCCCGACACATATTTCTTAAATGACAAAAAGTCATTTGTG
CATGGAGTGACAGTGAAAAACCGCATGATCCGTCTTCACCCTGATGGGACAGTGCTGTATGGGCTCAGA
ATCACCACGACAGCAGCATGCATGATGGACCTCAGGAGATACCCCCTGGACGAGCAGAACTGCACTCTG
GAAATTGAAAGCTATGGCTACACCACGGATGACATTGAGTTTTACTGGCGAGGCGGGGACAAGGCTGTT
ACCGGAGTGGAAAGGATTGAGCTCCCGCAGTTCTCCATCGTGGAGCACCGTCTGGTCTCGAGGAATGTT
GTCTTCGCCACAGGTGCCTATCCTCGACTGTCACTGAGCTTTCGGTTGAAGAGGAACATTGGATACTTC
ATTCTTCAGACTTATATGCCCTCTATACTGATAACGATTCTGTCGTGGGTGTCCTTCTGGATCAATTAT
GATGCATCTGCTGCTAGAGTTGCCCTCGGGATCACAACTGTGCTGACAATGACAACCATCAACACCCAC
CTTCGGGAGACCTTGCCCAAAATCCCCTATGTCAAAGCCATTGACATGTACCTTATGGGCTGCTTCGTC
TTTGTGTTCCTGGCCCTTCTGGAGTATGCCTTTGTCAACTACATTTTCTTTGGAAGAGGCCCTCAAAGG
CAGAAGAAGCTTGCAGAAAAGACAGCCAAGGCAAAGAATGACCGTTCAAAGAGCGAAAGCAACCGGGTG
GATGCTCATGGAAATATTCTGTTGACATCGCTGGAAGTTCACAATGAAATGAATGAGGTCTCAGGCGGC
ATTGGCGATACCAGGAATTCAGCAATATCCTTTGACAACTCAGGAATCCAGTACAGGAAACAGAGCATG
CCTCGAGAAGGGCATGGGCGATTCCTGGGGGACAGAAGCCTCCCGCACAAGAAGACCCATCTACGGAGG
AGGTCTTCACAGCTCAAAATTAAAATACCTGATCTAACCGATGTGAATGCCATAGACAGATGGTCCAGG
ATCGTGTTTCCATTCACTTTTTCTCTTTTCAACTTAGTTTACTGGCTGTACTATGTTAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278631
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278631.1
RefSeq Size 5889 bp
RefSeq ORF 1167 bp
Locus ID 2562
UniProt ID P28472
Cytogenetics 15q12
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 45 kDa
Gene Summary This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) contains an alternate internal exon and initiates translation at a downstream start codon, compared to variant 1. Variants 3 and 5 encode the same isoform (3), which is shorter at the N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.