SHMT1 (NM_001281786) Human Untagged Clone

CAT#: SC335498

SHMT1 (untagged) - Human serine hydroxymethyltransferase 1 (soluble) (SHMT1), transcript variant 3


  "NM_001281786" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SHMT1 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SHMT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SHMT1
Synonyms CSHMT; SHMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335498 representing NM_001281786.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCTGGACCTTCCGGATGGGGGCCACCTGACCCATGGGTTCATGACAGACAAGAAGAAAATCTCT
GCCACGTCCATCTTCTTTGAATCTATGCCCTACAAGGTGAACCCAGATACTGGCTACATCAACTATGAC
CAGCTGGAGGAGAACGCACGCCTCTTCCACCCGAAGCTGATCATCGCAGGAACCAGCTGCTACTCCCGA
AACCTGGAATATGCCCGGCTACGGAAGATTGCAGATGAGAACGGGGCGTATCTCATGGCGGACATGGCT
CACATCAGCGGGCTGGTGGCGGCTGGCGTGGTGCCCTCCCCATTTGAACACTGCCATGTGGTGACCACC
ACCACTCACAAGACCCTGCGAGGCTGCCGAGCTGGCATGATCTTCTACAGGAAAGGAGTGAAAAGTGTG
GATCCCAAGACTGGCAAAGAGATTCTGTACAACCTGGAGTCTCTTATCAATTCTGCTGTGTTCCCTGGC
CTGCAGGGAGGTCCCCACAACCACGCCATTGCTGGGGTTGCTGTGGCACTGAAGCAAGCTATGACTCTG
GAATTTAAAGTTTATCAACACCAGGTGGTGGCCAACTGCAGGGCTCTGTCTGAGGCCCTGACGGAGCTG
GGCTACAAAATAGTCACAGGTGGTTCTGACAACCATTTGATCCTTGTGGATCTCCGTTCCAAAGGCACA
GATGGTGGAAGGGCTGAGAAGGTGCTAGAAGCCTGTTCTATTGCCTGCAACAAGAACACCTGTCCAGGT
GACAGAAGCGCTCTGCGGCCCAGTGGACTGCGGCTGGGGACCCCAGCACTGACGTCCCGTGGACTTTTG
GAAAAAGACTTCCAAAAAGTAGCCCACTTTATTCACAGAGGGATAGAGCTGACCCTGCAGATCCAGAGC
GACACTGGTGTCAGAGCCACCCTGAAAGAGTTCAAGGAGAGACTGGCAGGGGATAAGTACCAGGCGGCC
GTGCAGGCTCTCCGGGAGGAGGTTGAGAGCTTCGCCTCTCTCTTCCCTCTGCCTGGCCTGCCTGACTTC
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001281786
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281786.1
RefSeq Size 2437 bp
RefSeq ORF 1038 bp
Locus ID 6470
UniProt ID P34896
Cytogenetics 17p11.2
Protein Pathways Cyanoamino acid metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Methane metabolism, One carbon pool by folate
MW 37.7 kDa
Gene Summary This gene encodes the cytosolic form of serine hydroxymethyltransferase, a pyridoxal phosphate-containing enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. This reaction provides one-carbon units for synthesis of methionine, thymidylate, and purines in the cytoplasm. This gene is located within the Smith-Magenis syndrome region on chromosome 17. A pseudogene of this gene is located on the short arm of chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) uses an alternate 5' exon structure, and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.