IL33 (NM_001199641) Human Untagged Clone
CAT#: SC329544
IL33 (untagged) - Homo sapiens interleukin 33 (IL33), transcript variant 3
"NM_001199641" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "IL33"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL33 |
Synonyms | C9orf26; DVS27; IL1F11; NF-HEV; NFEHEV |
Vector | pCMV6-Entry |
Sequence Data |
>SC329544 representing NM_001199641.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAA GCCTTGTGTTTCAAGCTGGGAAATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAA TCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCAT GCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTT GTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGT GTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTG TTTAAGCTCTCTGAAACTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199641 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199641.1 |
RefSeq Size | 2340 bp |
RefSeq ORF | 435 bp |
Locus ID | 90865 |
UniProt ID | O95760 |
Cytogenetics | 9p24.1 |
Protein Families | Secreted Protein |
Protein Pathways | Cytosolic DNA-sensing pathway |
MW | 16.2 kDa |
Gene Summary | The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (c, also known as 3) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.