PTGR1 (NM_001146109) Human Untagged Clone

CAT#: SC326870

PTGR1 (untagged)-Human prostaglandin reductase 1 (PTGR1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTGR1
• Synonyms: DIG-1; LTB4DH; PGR1; ZADH3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326870 representing NM_001146109.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTTCGTACTAAGACATGGACCCTGAAGAAGCACTTTGTTGGCTATCCTACTAATAGTGACTTTGAG
  TTGAAGACAGCTGAGCTCCCACCCTTAAAAAATGGAGAGGTCCTGCTTGAAGCTTTGTTCCTCACCGTG
  GATCCCTACATGAGAGTGGCAGCCAAAAGATTGAAGGAAGGTGATACAATGATGGGGCAGCAAGTGGCC
  AAAGTTGTGGAAAGTAAAAATGTAGCCCTACCAAAAGGAACTATTGTACTGGCTTCTCCAGGCTGGACA
  ACGCACTCCATTTCTGATGGGAAAGATCTGGAAAAGCTGCTGACAGAGTGGCCAGACACAATACCACTG
  TCTTTGGCTCTGGGGACAGTTGGCATGCCAGGCCTGACTGCCTACTTTGGCCTACTTGAAATCTGTGGT
  GTGAAGGGTGGAGAAACAGTGATGGTTAATGCAGCAGCTGGAGCTGTGGGCTCAGTCGTGGGGCAGATT
  GCAAAGCTCAAGGGCTGCAAAGTTGTTGGAGCAGTAGGGTCTGATGAAAAGGTTGCCTACCTTCAAAAG
  CTTGGATTTGATGTCGTCTTTAACTACAAGACGGTAGAGTCTTTGGAAGAAACCTTGAAGAAAGCGTCT
  CCTGATGGTTATGATTGTTATTTTGATAATGTAGGTGGAGAGTTTTCAAACACTGTTATCGGCCAGATG
  AAGAAATTTGGAAGGATTGCCATATGTGGAGCCATCTCTACATATAACAGAACCGGCCCACTTCCCCCA
  GGCCCACCCCCAGAGATTGTTATCTATCAGGAGCTTCGCATGGAAGCTTTTGTCGTCTACCGCTGGCAA
  GGAGATGCCCGCCAAAAAGCTCTGAAGGACTTGCTGAAATGGGTCTTAGAGATCAAAAGAGAAAATGAA
  GAAGATTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001146109
• Insert Size: 906 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001146109.1
• RefSeq Size: 1220 bp
• RefSeq ORF: 906 bp
• Locus ID: 22949
• UniProt ID: Q14914
• Cytogenetics: 9q31.3
• Protein Families: Druggable Genome
• MW: 32.9 kDa
• Gene Summary: This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter, compared to isoform 1.