ABCB5 (NM_001163993) Human Untagged Clone

CAT#: SC326700

ABCB5 (untagged)-Human ATP-binding cassette sub-family B (MDR/TAP) member 5 (ABCB5) transcript variant 4


  "NM_001163993" in other vectors (4)

Reconstitution Protocol

USD 240.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Anti-ABCB5 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ABCB5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABCB5
Synonyms ABCB5alpha; ABCB5beta; EST422562
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326700 representing NM_001163993.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGAGTGGTTAGT
CAAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGACGAGATGATGTGACTGAT
GAAGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGATTTTATCATGGAGTTTCCTAATAAATTT
AATACATTGGTAGGGGAAAAAGGAGCTCAAATGAGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGT
GCCTTAGTTCGAAACCCCAAGATTCTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAG
TCAGCTGTTCAAGCTGCACTGGAGAAGAAAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001163993
Insert Size 381 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001163993.2
RefSeq Size 1724 bp
RefSeq ORF 381 bp
Locus ID 340273
UniProt ID Q2M3G0
Cytogenetics 7p21.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways ABC transporters
MW 14.1 kDa
Gene Summary ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus and a shorter and distinct C-terminus, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.