Retinoic Acid Receptor alpha (RARA) (NM_001145302) Human Untagged Clone

CAT#: SC325829

RARA (untagged)-Human retinoic acid receptor, alpha (RARA), transcript variant 4


  "NM_001145302" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
RARA mouse monoclonal antibody, clone OTI2C3 (formerly 2C3)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Retinoic Acid Receptor alpha"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Retinoic Acid Receptor alpha
Synonyms NR1B1; RAR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325829 representing NM_001145302.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCGGTGCCTCCC
TACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCAC
CAGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCACTGTGAGAAACGACCGAAACAAGAAGAAG
AAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAG
AAGGTGCGCAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACAAC
AGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAACTCTCCACCAAGTGC
ATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACCACCCTCACCATCGCCGACCAGATC
ACCCTCCTCAAGGCTGCCTGCCTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAG
GACACCATGACCTTCTCGGACGGGCTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCC
CTCACCGACCTGGTCTTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGG
CTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATG
CTGCAGGAGCCGCTGCTGGAGGCGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATG
TTCCCCAAGATGCTAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGGGGGCTGAGCGGGTGATC
ACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCCAGGAAATGTTGGAGAACTCAGAGGGC
CTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGC
AGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145302
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145302.2
RefSeq Size 3122 bp
RefSeq ORF 1098 bp
Locus ID 5914
UniProt ID P10276
Cytogenetics 17q21.2
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Acute myeloid leukemia, Pathways in cancer
MW 39.7 kDa
Gene Summary This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
Transcript Variant: This variant (4) reflects the use of an alternate promoter and contains a different 5' UTR segment. This variant also lacks two in-frame coding exons, compared to variant 1. The resulting protein (isoform 4) is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.