Leukotriene B4 Receptor (LTB4R) (NM_001143919) Human Untagged Clone

CAT#: SC324982

LTB4R (untagged)-Human leukotriene B4 receptor (LTB4R), transcript variant 2


  "NM_001143919" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-Human BLT1 (extracellular)
    • 50 ul

USD 850.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Leukotriene B4 Receptor"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Leukotriene B4 Receptor
Synonyms BLT1; BLTR; CMKRL1; GPR16; LTB4R1; LTBR1; P2RY7; P2Y7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324982 representing NM_001143919.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACACTACATCTTCTGCAGCACCCCCCTCACTAGGTGTAGAGTTCATCTCTCTGCTGGCTATCATC
CTGCTGTCAGTGGCGCTGGCTGTGGGGCTTCCCGGCAACAGCTTTGTGGTGTGGAGTATCCTGAAAAGG
ATGCAGAAGCGCTCTGTCACTGCCCTGATGGTGCTGAACCTGGCCCTGGCCGACCTGGCCGTATTGCTC
ACTGCTCCCTTTTTCCTTCACTTCCTGGCCCAAGGCACCTGGAGTTTTGGACTGGCTGGTTGCCGCCTG
TGTCACTATGTCTGCGGAGTCAGCATGTACGCCAGCGTCCTGCTTATCACGGCCATGAGTCTAGACCGC
TCACTGGCGGTGGCCCGCCCCTTTGTGTCCCAGAAGCTACGCACCAAGGCGATGGCCCGGCGGGTGCTG
GCAGGCATCTGGGTGTTGTCCTTTCTGCTGGCCACACCCGTCCTCGCGTACCGCACAGTAGTGCCCTGG
AAAACGAACATGAGCCTGTGCTTCCCGCGGTACCCCAGCGAAGGGCACCGGGCCTTCCATCTAATCTTC
GAGGCTGTCACGGGCTTCCTGCTGCCCTTCCTGGCTGTGGTGGCCAGCTACTCGGACATAGGGCGTCGG
CTACAGGCCCGGCGCTTCCGCCGCAGCCGCCGCACCGGCCGCCTGGTGGTGCTCATCATCCTGACCTTC
GCCGCCTTCTGGCTGCCCTACCACGTGGTGAACCTGGCTGAGGCGGGCCGCGCGCTGGCCGGCCAGGCC
GCCGGGTTAGGGCTCGTGGGGAAGCGGCTGAGCCTGGCCCGCAACGTGCTCATCGCACTCGCCTTCCTG
AGCAGCAGCGTGAACCCCGTGCTGTACGCGTGCGCCGGCGGCGGCCTGCTGCGCTCGGCGGGCGTGGGC
TTCGTCGCCAAGCTGCTGGAGGGCACGGGCTCCGAGGCGTCCAGCACGCGCCGCGGGGGCAGCCTGGGC
CAGACCGCTAGGAGCGGCCCCGCCGCTCTGGAGCCCGGCCCTTCCGAGAGCCTCACTGCCTCCAGCCCT
CTCAAGTTAAACGAACTGAACTAG

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001143919
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143919.2
RefSeq Size 2723 bp
RefSeq ORF 1059 bp
Locus ID 1241
UniProt ID Q15722
Cytogenetics 14q12
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 37.6 kDa
Gene Summary Receptor for extracellular ATP > UTP and ADP. The activity of this receptor is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. May be the cardiac P2Y receptor involved in the regulation of cardiac muscle contraction through modulation of L-type calcium currents. Is a receptor for leukotriene B4, a potent chemoattractant involved in inflammation and immune response.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.