TSH Receptor (TSHR) (NM_001018036) Human Untagged Clone

CAT#: SC302133

TSHR (untagged)-Human thyroid stimulating hormone receptor (TSHR), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TSH Receptor
• Synonyms: CHNG1; hTSHR-I; LGR3
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001018036, the custom clone sequence may differ by one or more nucleotides
  ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGC
  GGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACC
  TGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATT
  GAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGA
  ATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTG
  AGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGAT
  GCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATG
  TTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGAC
  AACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTG
  ACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACA
  AAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCA
  TTTGGAGGAGTATACAGTGGACCAAGCTTGCTGCTACCTCTTGGAAGAAAGTCCTTGTCC
  TTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001018036
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001018036.1, NP_001018046.1
• RefSeq Size: 1183 bp
• RefSeq ORF: 762 bp
• Locus ID: 7253
• UniProt ID: P16473
• Cytogenetics: 14q31.1
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Autoimmune thyroid disease, Neuroactive ligand-receptor interaction
• Gene Summary: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
  Transcript Variant: This variant (2), also called ST4, differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.