E2f1 (NM_001291105) Mouse Untagged Clone

CAT#: MC227430

E2f1 (untagged) - Mouse E2F transcription factor 1 (E2f1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: E2f1
• Synonyms: E2F-1; mKIAA4009; Tg(Wnt1-cre)2Sor
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227430 representing NM_001291105
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGAAGTGCTTCACGCAGCTGCAGATGGTGGGGCTGATATTTGAACTGATGTCTGCTGGCTTGCTGC
  AGAACCTATGGCTAGGGAGTGCGCACAGTTGCTTGTTGGAGGTGAAACGGAGGCTGGATCTGGAGACTGA
  CCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAA
  TCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGA
  GCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCAT
  CTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGG
  CTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGC
  AGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGA
  CTCCGACACCCAGCGCCTGGCCTATGTGACCTGCCAGGACCTTCGCAGCATTGCAGACCCTGCAGAACAG
  ATGGTCATAGTGATCAAGGCCCCTCCTGAGACCCAACTACAAGCTGTGGATTCTTCAGAGACATTTCAGA
  TCTCCCTTAAGAGCAAACAAGGCCCCATTGATGTTTTCCTGTGCCCGGAGGAGAGTGCAGACGGGATTAG
  CCCTGGGAAGACCTCATGCCAGGAGACATCCTCTGGGGAGGACCGGACTGCAGACTCTGGCCCAGCAGGG
  CCTCCACCATCACCTCCCTCCACATCCCCAGCCTTGGATCCCAGTCAATCCCTGTTGGGCCTGGAGCAAG
  AAGCAGTATTGCCACGGATGGGCCACCTGAGGGTCCCTATGGAAGAGGACCAACTGTCACCACTGGTGGC
  TGCTGACTCACTCCTGGAGCATGTTAAAGAAGACTTCTCTGGGCTCCTCCCTGGGGAGTTCATCAGCCTC
  TCCCCACCCCACGAGGCCCTTGACTATCACTTTGGTCTCGAGGAGGGTGAGGGCATTAGAGATCTCTTTG
  ACTGTGACTTTGGGGACCTGACCCCTCTGGATTTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291105
• Insert Size: 1158 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291105.1, NP_001278034.1
• RefSeq Size: 2695 bp
• RefSeq ORF: 1158 bp
• Locus ID: 13555
• Cytogenetics: 2 76.79 cM
• Gene Summary: Transcription activator that binds DNA cooperatively with DP proteins through the E2 recognition site, 5'-TTTC[CG]CGC-3' found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The DRTF1/E2F complex functions in the control of cell-cycle progression from G1 to S phase. E2F1 binds preferentially RB1 in a cell-cycle dependent manner. It can mediate both cell proliferation and TP53/p53-dependent apoptosis. Blocks adipocyte differentiation by binding to specific promoters repressing CEBPA binding to its target gene promoters (PubMed:11672531, PubMed:20176812). Positively regulates transcription of RRP1B (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an altnerate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.