Pla2g10 (NM_001291009) Mouse Untagged Clone

CAT#: MC225896

Pla2g10 (untagged) - Mouse phospholipase A2, group X (Pla2g10), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pla2g10
• Synonyms: GX sPLA2; mGXs; PLA; PLA2GX; sPLA2-X
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225896 representing NM_001291009
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGCTGCTACTGCTGCTGTTGCTGCTGGGACCTGGACCCGGATTCAGCGAAGCAACCAGGAGGTCAC
  ATGTATACAAGCGTGGACTCCTGGAGCTGGCAGGGACCTTGGATTGTGTTGGGCCTCGATCTCCGATGGC
  TTACATGAACTATGGCTGTTATTGTGGCCTTGGTGGCCATGGAGAGCCACGTGACGCCATTGACTGGTGC
  TGCTACCACCACGACTGCTGCTACTCTCGGGCTCAGGACGCTGGCTGCAGCCCTAAGTTAGACCGCTACC
  CATGGAAGTGCATGGACCATCACATCCTGTGTGGTGAGTGCCCTATGCCGTGTGACTTCCCCAAGTGCCC
  ACTGGACATCCTGCAGATCCCAATGGCTCCTGTACCCTTGTGGACCAGCAGAGAACAAATGCCAAGAACT
  TTTGTGCAGGTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291009
• Insert Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291009.2, NP_001277938.1
• RefSeq Size: 1005 bp
• RefSeq ORF: 435 bp
• Locus ID: 26565
• Cytogenetics: 16 9.5 cM
• Gene Summary: This gene encodes a member of the phospholipase A2 family of lipolytic enzymes that hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. The encoded protein undergoes proteolytic processing to generate a calcium-dependent enzyme that plays pivotal roles in the liberation of arachidonic acid from membrane phospholipids leading to the production of various inflammatory lipid mediators, such as prostaglandins. In response to myocardial ischemia/reperfusion, mice lacking the encoded protein display a reduction in myocardial infarct size partly through the suppression of neutorphil cytotoxic activities. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.