Fzd3 (NM_021458) Mouse Untagged Clone

CAT#: MC220238

Fzd3 (untagged) - Mouse frizzled homolog 3 (Drosophila) (Fzd3), (10ug)


  "NM_021458" in other vectors (4)

Reconstitution Protocol

USD 672.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fzd3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fzd3
Synonyms AU020229; D930050A07Rik; Fz3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC220238 representing NM_021458
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGTGAGCTGGATTGTCTTTGATCTTTGGCTCTTGACTGTGTTTCTGGGGCAGATAGGTGGGCACA
GTTTGTTTTCTTGTGAACCTATAACCTTGAGGATGTGCCAAGATTTGCCTTACAATACTACCTTCATGCC
TAATCTTCTGAACCATTATGACCAACAGACTGCAGCTTTAGCAATGGAGCCCTTCCACCCTATGGTGAAC
CTGGATTGTTCTCGGGATTTTCGGCCATTTCTTTGTGCACTCTATGCCCCTATTTGTATGGAATATGGAC
GTGTCACACTTCCCTGCCGTAGGCTGTGTCAGCGTGCCTATAGCGAGTGTTCAAAACTCATGGAGATGTT
TGGTGTCCCGTGGCCTGAAGATATGGAGTGCAGTAGGTTTCCAGATTGTGATGAGCCATATCCCCGACTT
GTGGATTTGAATTTAGTTGGAGATCCAACTGAAGGAGCCCCAGTTGCAGTGCAGAGGGACTATGGTTTTT
GGTGTCCCAGAGAGTTAAAAATTGATCCTGATCTTGGCTATTCCTTTCTGCACGTGCGAGATTGTTCGCC
ACCATGTCCCAATATGTACTTCAGGAGAGAAGAACTGTCATTTGCTCGCTATTTCATAGGCCTGATTTCA
ATCATTTGCCTCTCTGCCACATTGTTTACTTTTTTAACCTTTCTAATTGACGTCACAAGATTCCGTTACC
CTGAAAGACCTATCATATTTTATGCAGTCTGCTACATGATGGTGTCATTAATTTTCTTCATTGGGTTTTT
GCTGGAGGACCGAGTAGCCTGCAATGCATCTAGCCCTGCACAGTATAAGGCTTCTACAGTGACACAAGGA
TCTCACAATAAGGCCTGTACCATGCTCTTTATGGTACTATATTTTTTCACTATGGCTGGCAGTGTATGGT
GGGTAATTCTTACCATCACATGGTTTTTAGCAGCTGTGCCAAAGTGGGGCAGTGAAGCTATTGAGAAGAA
AGCATTGCTGTTTCATGCCAGTGCCTGGGGCATCCCCGGAACTCTAACTATCATCCTTTTAGCGATGAAT
AAAATTGAAGGTGACAATATTAGTGGCGTGTGTTTTGTCGGCCTCTACGACGTTGATGCATTAAGATATT
TCGTTCTCGCTCCCCTCTGCCTGTATGTGGTAGTTGGGGTTTCTCTCCTTTTAGCCGGCATTATATCCCT
AAACAGAGTTCGGATTGAGATCCCATTAGAAAAGGAAAACCAAGATAAGTTAGTGAAGTTCATGATCCGG
ATTGGTGTTTTCAGCATTCTCTACCTTGTGCCACTCTTGGTTGTAATTGGATGTTACTTTTATGAGCAAG
CTTACCGCGGCATCTGGGAGACAACATGGATCCAGGAACGCTGCAGAGAGTATCACATTCCATGTCCGTA
CCAGGTTACTCAGATGAGTCGTCCAGACCTGATTCTCTTTCTGATGAAGTATCTCATGGCTCTCATAGTT
GGGATTCCCTCTATATTTTGGGTTGGAAGCAAAAAGACATGCTTTGAATGGGCCAGTTTTTTCCATGGGC
GTAGGAAAAAAGAGATAGTGAATGAGAGCCGGCAGGTGCTCCAGGAACCTGACTTTGCTCAGTCACTCCT
GAGGGACCCAAATACTCCAATTATAAGAAAATCAAGAGGAACTTCCACTCAAGGGACATCCACACATGCT
TCTTCAACTCAGCTGGCCATGGTGGATGACCAAAGAAGCAAAGCAGGGAGTGTCCACAGCAAAGTGAGCA
GCTACCATGGCAGCCTCCACAGGTCACGGGATGGCAGGTACACTCCCTGCAGTTACCGAGGAATGGAGGA
GAGACTACCTCACGGCAGCATGTCACGGCTGACGGATCATTCCAGGCACAGTAGTTCTCATCGGCTCAAC
GAGCAGTCCCGACACAGCAGCATCCGAGACCTCAGTAACAACCCCATGACTCACATTACACATGGCACCA
GCATGAACCGTGTTATTGAGGAGGATGGAACCAGTGCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021458
Insert Size 2001 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021458.2, NP_067433.1
RefSeq Size 12742 bp
RefSeq ORF 2001 bp
Locus ID 14365
UniProt ID Q61086
Cytogenetics 14 34.09 cM
Gene Summary Receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Activation by Wnt5A stimulates PKC activity via a G-protein-dependent mechanism. Involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Plays a role in controlling early axon growth and guidance processes necessary for the formation of a subset of central and peripheral major fiber tracts. Required for the development of major fiber tracts in the central nervous system, including: the anterior commissure, the corpus callosum, the thalamocortical, corticothalamic and nigrostriatal tracts, the corticospinal tract, the fasciculus retroflexus, the mammillothalamic tract, the medial lemniscus, and ascending fiber tracts from the spinal cord to the brain. In the peripheral nervous system, controls axon growth in distinct populations of cranial and spinal motor neurons, including the facial branchimotor nerve, the hypoglossal nerve, the phrenic nerve, and motor nerves innervating dorsal limbs. Involved in the migration of cranial neural crest cells. May also be implicated in the transmission of sensory information from the trunk and limbs to the brain. Controls commissural sensory axons guidance after midline crossing along the anterior-posterior axis in the developing spinal cord in a Wnt-dependent signaling pathway. Together with FZD6, is involved in the neural tube closure and plays a role in the regulation of the establishment of planar cell polarity (PCP), particularly in the orientation of asymmetric bundles of stereocilia on the apical faces of a subset of auditory and vestibular sensory cells located in the inner ear. Promotes neurogenesis by maintaining sympathetic neuroblasts within the cell cycle in a beta-catenin-dependent manner.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.