Elovl1 (NM_019422) Mouse Untagged Clone
CAT#: MC209963
Elovl1 (untagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 (Elovl1), transcript variant 2, (10ug)
"NM_019422" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Elovl1 |
Synonyms | AA407424; BB151133; Ssc1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209963 representing NM_019422
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCTGTTGTGAACTTGTACCACGAGCTGATGAAGCATGCGGATCCCCGGATCCAAAGCTACCCTC TGATGGGGTCCCCCTTGCTAATAACATCCATCCTTCTGACCTATGTGTACTTCATCCTATCGCTTGGGCC TCGAATCATGGCTAATCGGAAGCCCTTCCAACTTCGAGGCTTCATGATTGTCTACAATTTCTCACTGGTG ATACTCTCCCTCTACATTGTCTATGAGTTTCTGATGTCTGGTTGGCTGAGTACCTACACCTGGCGCTGTG ACCCCATAGACTTTTCCAATAGCCCTGAAGCACTTCGGATGGTTCGAGTGGCCTGGCTCTTCATGCTTTC CAAGGTCATTGAGCTGATGGACACAGTGATATTTATCCTCCGGAAGAAGGACGGGCAAGTGACCTTCCTC CATGTCTTCCACCACTCGGTGCTTCCCTGGAGTTGGTGGTGGGGGATAAAAATTGCTCCAGGAGGAATGG GCTCCTTCCATGCCATGATAAACTCCTCTGTACATGTCGTCATGTACCTCTACTATGGATTGTCTGCCCT TGGCCCTGTGGCCCAGCCCTACCTTTGGTGGAAGAAACATATGACTGCCATTCAGCTGATCCAGTTTGTC CTGGTCTCACTGCACATCAGCCAATACTACTTCATGCCCAGCTGCAACTACCAGTACCCCATCATCATCC ACCTCATCTGGATGTATGGCACCATCTTCTTCATACTGTTCTCCAATTTCTGGTATCACTCTTACACCAA GGGGAAGCGGCTGCCCCGTGCAGTTCAGCAAAATGGAGCTCCAGCTACCACCAAGGTCAAGGCCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_019422 |
Insert Size | 840 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019422.2, NP_062295.1 |
RefSeq Size | 1826 bp |
RefSeq ORF | 840 bp |
Locus ID | 54325 |
UniProt ID | Q9JLJ5 |
Cytogenetics | 4 D2.1 |
Gene Summary | Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis. Indirectly inhibits RPE65 via production of VLCFAs.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216933 | Elovl1 (tGFP-tagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2 SUR4/Elo3 yeast)-like 1 (Elovl1) transcript variant 2, (10ug) |
USD 650.00 |
|
MR216933 | Elovl1 (Myc-DDK-tagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 (Elovl1), transcript variant 2 |
USD 450.00 |
|
MR216933L3 | Lenti ORF clone of Elovl1 (Myc-DDK-tagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 (Elovl1), transcript variant 2 |
USD 750.00 |
|
MR216933L4 | Lenti ORF clone of Elovl1 (mGFP-tagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 (Elovl1), transcript variant 2 |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review