Thra (NM_178060) Mouse Untagged Clone

CAT#: MC209527

Thra (untagged) - Mouse thyroid hormone receptor alpha (Thra), (10ug)


  "NM_178060" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
THRA Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Thra"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Thra
Synonyms 6430529J03Rik; AW259572; c-erb; c-erbA-1; c-erbA-alpha; c-erbAalpha; Er; Erba; Nr; Nr1a1; Rvr; T3R; T3Ralpha; T3R[; T3R[a]; Thr; Thra1; Thra2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209527 representing NM_178060
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACAGAAGCCAAGCAAGGTGGAGTGTGGGTCAGACCCAGAGGAGAACAGTGCCAGGTCACCAGATG
GAAAGCGAAAAAGAAAGAACGGCCAATGTCCCCTGAAAAGCAGCATGTCAGGGTATATCCCTAGTTACCT
GGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAAGGCCACCGGTTATCACTACCGCTGTATCACTTGT
GAGGGCTGCAAGGGCTTCTTTCGCCGCACAATCCAGAAGAATCTCCATCCCACCTATTCCTGCAAGTATG
ACAGCTGCTGTGTCATCGACAAGATCACCCGGAATCAGTGCCAGCTGTGCCGCTTCAAGAAGTGCATTGC
TGTGGGCATGGCCATGGACTTGGTTCTAGATGATTCGAAGCGGGTGGCCAAACGCAAGCTGATTGAGCAG
AACCGGGAGAGGAGGCGAAAGGAGGAGATGATTCGCTCACTGCAGCAGCGACCAGAGCCCACTCCTGAAG
AGTGGGACCTGATACATGTTGCTACAGAGGCCCATCGCAGCACTAACGCCCAGGGCAGCCATTGGAAACA
GAGGCGAAAATTCCTGCCGGATGACATTGGCCAGTCACCTATTGTCTCCATGCCGGACGGAGACAAGGTA
GACCTAGAGGCCTTCAGCGAGTTTACCAAGATCATCACCCCGGCCATCACGCGCGTGGTGGACTTTGCCA
AAAAACTGCCCATGTTCTCCGAGCTGCCTTGCGAAGACCAGATCATCCTCCTGAAGGGCTGCTGCATGGA
GATCATGTCCCTGCGGGCAGCTGTCCGCTACGACCCTGAGAGTGACACCCTGACCCTGAGTGGGGAGATG
GCGGTTAAGCGGGAACAGCTCAAGAATGGTGGCTTGGGTGTGGTCTCTGACGCCATCTTTGAACTGGGCA
AGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTGCAGGCTGTGCTGCTAATGTCAAC
AGACCGCTCCGGCCTGCTGTGCGTGGACAAGATCGAGAAGAGTCAGGAGGCCTACCTGCTGGCGTTTGAG
CACTACGTCAACCACCGCAAACACAACATTCCGCACTTCTGGCCCAAGCTGCTGATGAAGGTGACTGACC
TCCGCATGATCGGGGCCTGCCACGCCAGCCGCTTCCTCCACATGAAAGTCGAGTGCCCCACCGAACTCTT
CCCCCCACTCTTCCTGGAGGTCTTTGAGGATCAGGAAGTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_178060
Insert Size 1233 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178060.4, NP_835161.1
RefSeq Size 2246 bp
RefSeq ORF 1233 bp
Locus ID 21833
UniProt ID P63058
Cytogenetics 11 62.58 cM
Gene Summary The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.