Arg2 (NM_009705) Mouse Untagged Clone

CAT#: MC204188

Arg2 (untagged) - Mouse arginase type II (Arg2), (10ug)


  "NM_009705" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ARG2 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Arg2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arg2
Synonyms AII; AU022422
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC023349
GTTGCACCGAGCCGGTTCTCCTAGGGTAATCCCCTCCCTGCCAATCATGTTCCTGAGGAGCAGCGCCTCC CGTCTCCTCCACGGGCAAATTCCTTGCGTCCTGACGAGATCCGTCCACTCTGTAGCTATAGTCGGAGCCC CTTTCTCTCGGGGACAGAAGAAGCTAGGAGTGGAATATGGTCCAGCTGCCATTCGAGAAGCTGGCTTGCT GAAGAGGCTCTCCAGGTTGGGATGCCACCTAAAAGACTTTGGAGACTTGAGTTTTACTAATGTCCCACAA GATAATCCCTACAATAATCTGGTTGTGTATCCTCGTTCAGTGGGCCTTGCCAACCAGGAACTGGCTGAAG TGGTTAGTAGAGCTGTGTCAGGTGGCTACAGCTGTGTCACCATGGGAGGAGACCACAGCCTGGCAATAGG TACCATTATCGGTCACGCCCGGCACCGCCCAGATCTCTGTGTCATCTGGGTTGATGCTCATGCGGACATT AATACACCTCTCACCACTGTATCTGGAAATATACATGGACAGCCACTTTCCTTTCTCATCAAAGAACTAC AAGACAAGGTACCACAACTGCCAGGATTTTCCTGGATCAAACCTTGCCTCTCTCCCCCAAATATTGTGTA CATTGGCCTGAGAGATGTGGAGCCTCCTGAACATTTTATTTTAAAGAATTATGACATCCAGTATTTTTCC ATGAGAGAGATTGATCGACTTGGGATCCAGAAGGTGATGGAACAGACATTTGATCGGCTGATTGGCAAAA GGCAGAGGCCAATCCACCTGAGTTTTGATATTGATGCATTTGACCCTAAATTGGCTCCAGCCACAGGAAC CCCTGTTGTAGGGGGATTAACCTACAGAGAAGGAGTGTATATTACTGAAGAAATACATAATACAGGGTTG CTGTCAGCTCTGGATCTTGTTGAAGTCAATCCTCATTTGGCCACTTCTGAGGAAGAGGCCAAGGCAACAG CCAGACTAGCAGTGGATGTGATTGCTTCAAGTTTTGGTCAGACAAGAGAAGGAGGACACATTGTCTATGA CCACCTTCCTACTCCTAGTTCACCACACGAATCAGAAAATGAAGAATGTGTGAGAATTTAGGAAATACTG TACTCTGGCACCTTTCACAACAGCATTCCAGAGTTGCAAGGCATTCGAAGGGACAGATATGAAATGGCTG TCTGGATCAATATTGCCTTAATGAGAACATCTGTGCACTCTCACAACTGTAAAACTCCCTTCTCTATTTT GGTCACCAACACTATTACTGTAAATGTATTTTTTGTTGTTTTTGAAGTTTACAAGCTATTAATGTTATAC ATGTAAGTTTGAAGGAGTCATAAACAACATTTATTACCTTAGTATATCATAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009705
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC023349, AAH23349
RefSeq Size 1396 bp
RefSeq ORF 1065 bp
Locus ID 11847
UniProt ID O08691
Cytogenetics 12 C3
Gene Summary May play a role in the regulation of extra-urea cycle arginine metabolism and also in down-regulation of nitric oxide synthesis. Extrahepatic arginase functions to regulate L-arginine bioavailability to nitric oxid synthase (NOS). Arginine metabolism is a critical regulator of innate and adaptive immune responses. Seems to be involved in negative regulation of the survival capacity of activated CD4(+) and CD8(+) T cells (PubMed:27745970, PubMed:25009204). May suppress inflammation-related signaling in asthmatic airway epithelium (PubMed:27214549). May contribute to the immune evasion of H.pylori by restricting M1 macrophage activation and polyamine metabolism (PubMed:27074721). May play a role in promoting prenatal immune suppression (By similarity). Regulates RPS6KB1 signaling, which promotes endothelial cell senescence and inflammation and implicates NOS3/eNOS dysfunction (PubMed:22928666). Can inhibit endothelial autophagy independently of its enzymatic activity implicating mTORC2 signaling (PubMed:25484082). Involved in vascular smooth muscle cell senescence and apoptosis independently of its enzymatic activity (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.