Fcer1g (NM_010185) Mouse Untagged Clone

CAT#: MC201832

Fcer1g (untagged) - Mouse Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g), (10ug)


  "NM_010185" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fcer1g"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fcer1g
Synonyms AI573376; CD23; Fce1g; FcepsilonRI; FcR-gamma; FcRgamma; FcR[g]; Ly-50
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC034163 sequence for NM_010185
CGCGATCACCAGCTCCCAGCGCCGCAGCCCCCAGCGCACCCAGGATGATCTCAGCCGTGATCTTGTTCTT GCTCCTTTTGGTGGAACAAGCAGCCGCCCTGGGAGAGCCGCAGCTCTGCTATATCCTGGATGCTGTCCTG TTTTTGTATGGTATTGTCCTTACCCTACTCTACTGTCGACTCAAGATCCAGGTCCGAAAGGCAGCTATAG CCAGCCGTGAGAAAGCAGATGCTGTCTACACGGGCCTGAACACCCGGAGCCAGGAGACATATGAGACTCT GAAGCATGAGAAACCACCCCAGTAGCTTCAGAACAGACGTGCTTGGCTGCATTCTTTTCCCACTTCTAAT TCTCTCCGAGCCCTCTTGGTCACCTCTGTGCTTTGAAGGTTGGCTGACCTTATTCACATAATGATGCTAG CTAGGCTCTACATCAGTGTACACTGGCAGGTCCCCATCTCCGTTAAAGACTTACTCACTGACATTTCTCT TCTTCCAGCCTCCTTTGCTTCATTTCTTTTTCCTTCCCTGATCCTCGACTCTCACTAAACAATGGAAAGG GATTATCCCCCAATAAAGCTGCCAGAGACCTGACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010185
Insert Size 261 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC034163, AAH34163
RefSeq Size 800 bp
RefSeq ORF 261 bp
Locus ID 14127
UniProt ID P20491
Cytogenetics 1 79.23 cM
Gene Summary Adapter protein containing an immunoreceptor tyrosine-based activation motif (ITAM) that transduces activation signals from various immunoreceptors. As a component of the high-affinity immunoglobulin E (IgE) receptor, mediates allergic inflammatory signaling in mast cells (PubMed:14764707). As a constitutive component of interleukin-3 receptor complex, selectively mediates interleukin 4/IL4 production by basophils, priming T-cells toward effector T-helper 2 subset (PubMed:19098920). Associates with pattern recognition receptors CLEC4D and CLEC4E to form a functional signaling complex in myeloid cells. Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of ITAM, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766) (Probable). May function cooperatively with other activating receptors. Functionally linked to integrin beta-2/ITGB2-mediated neutrophil activation (PubMed:17086186). Also involved in integrin alpha-2/ITGA2-mediated platelet activation (PubMed:9171347).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.