Caspase 5 (CASP5) (NM_001136111) Human 3' UTR Clone

CAT#: SC200800

3' UTR clone of caspase 5 apoptosis-related cysteine peptidase (CASP5) transcript variant d for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP5
• Synonyms: Caspase 5; caspase 5, apoptosis-related cysteine peptidase; caspase 5, apoptosis-related cysteine protease; ICE(rel)III; ICEREL-III; ICH-3; MGC141966; OTTHUMP00000045729; TY protease
• ACCN: NM_001136111
• Insert Size: 142 bp
• Sequence Data:
  Insert Sequence

  >SC200800 3’UTR clone of NM_001136111
  The sequence shown below is from the reference sequence of NM_001136111. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AGAGATTTCTACCTCTTTCCTGGCAATTGAAAATGAAACCACAGGCAGCCCAGCCCTCCTCTGTCAACA
  TCAAAGAGCACATTTACCAGTATAGCTTGCATAGTCAATATTTGGTATTTCAATAAAAGTAAAGACTGT
  ATCT
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001136111.1
• Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
• Locus ID: 838
• MW: 5.5