CENTB1 (ACAP1) (NM_014716) Human 3' UTR Clone

CAT#: SC200526

3' UTR clone of ArfGAP with coiled-coil ankyrin repeat and PH domains 1 (ACAP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACAP1
• Synonyms: CENTB1
• ACCN: NM_014716
• Insert Size: 112 bp
• Sequence Data:
  Insert Sequence

  >SC200526 3’UTR clone of NM_014716
  The sequence shown below is from the reference sequence of NM_014716. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CGTCGCAGTCATGACCTCCACACGCTGTGACCCGAGGCCCACGGGGCCCGCGCCTGCCTCCCTTCCCCG
  CCACCGGGCCCTCTGCCATTAAAGCCTCCGTGCTTCGCTCTTC
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_014716.4
• Summary: GTPase-activating protein (GAP) for ADP ribosylation factor 6 (ARF6) required for clathrin-dependent export of proteins from recycling endosomes to trans-Golgi network and cell surface. Required for regulated export of ITGB1 from recycling endosomes to the cell surface and ITGB1-dependent cell migration.[UniProtKB/Swiss-Prot Function]
• Locus ID: 9744
• MW: 4