MIR218a-1 Rat qPCR Primer Pair (MI0000958)

CAT#: RP300125

MIR218a-1 (Rat) qSTAR miRNA primer pairs - 200 reactions



SensiMix SYBR Master Mix

USD 189.00

3 Days*

Size
    • 200 reactions

Product Images

Other products for "MIR218a-1"

Specifications

Product Data
Gene ID 100314248
Forward Sequence TTGTGCTTGATCTAACCATG
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0000888
Synonyms MI0000958; MIMAT0000888; MIR218a-1 rno-mir-218a-1; rno-miR-218a-5p
Component 1 vial of lyophilized qSTAR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.